S2-RNase, S2-RNase (gene) Prunus japonica

Gene Overview
Name S2-RNase
Gene Symbol S2-RNase
Type gene
Organism Prunus japonica
Synonym S2-RNase
Description NA
Comment ribonuclease; self-incompatibility RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2-RNaseEF635418.1-S2-RNasePrunus japonicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2-RNaseEF635418.1-S2-RNase.m1Prunus japonicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus japonicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EF635418.1-S2-RNase N/A EF635418.1
mRNA parsed from NCBI nr database EF635418.1-S2-RNase.m1 N/A EF635418.1

Sequence(s):
>EF635418.1-S2-RNase413
tcaccattcatggcctatggccaagtaatcattcaaacccaacgatgcccagtaattgcaatgggacgcaatttaagcga
atattggtatgtattgtttcgttttttattttcacatactctttagtatttagttttaaaaaaattatagattgtcatct
gaaaaaagaagtacttctttcaataagctttgggtgttacataatgataggtttggaaattggtgttaaacgaagagaac
aatctcacccaagaatcaataaaatcgtttttactttttctcaaaatatgtatatattgcttggatatctcagccccctg
atttgcgatccgatctgacgagatcttggccggacgtggaaagtggtgatgatacaaaattttgggaaggcgaatggaac
aagcacggcacat
back to top
>EF635418.1-S2-RNase.m1186
tcaccattcatggcctatggccaagtaatcattcaaacccaacgatgcccagtaattgcaatgggacgcaatttaagcga
atattgccccctgatttgcgatccgatctgacgagatcttggccggacgtggaaagtggtgatgatacaaaattttggga
aggcgaatggaacaagcacggcacat
back to top