S2-RNase, S2-RNase (gene) Prunus simonii

Gene Overview
Name S2-RNase
Gene Symbol S2-RNase
Type gene
Organism Prunus simonii
Synonym S2-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus simoniigene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2-RNaseEU918172.1-S2-RNase.m1Prunus simoniimRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU918172.1-S2-RNase.m1 N/A EU918172.1

Sequence(s):
>EU918172.1-S2-RNase.m1572
ttccttgttcttgctttcttcttgtgtttcataatgagcactggtgatggaacttatgactatttccaatttgtgcaaca
atggccaccgaccacttgcggagttcgcgggaaaccttgctccaaaccccggctattacaaaatttcaccattcatggcc
tatggtcaagtaattattcaaacccaacgatgcctagtaattgcaatgggtcgaaatttgaggcaaggaaagtgtaccct
caattgcgatccgatctgaagatatcttggccggacgtggaaagtggcaatgacacaaaattttgggaaggcgaatggaa
caaacacggcacttgttccgaacagatacttaaccaaatgcaatacttcgagcgatcccacgcaatgtggacctcgtaca
atattacgaaaatccttaaaaatgcttcaatcgtaccaagtgcgaaacaaaaatggaagtactcggacatactatcaccc
attaaaacagcaactggaagaacgcccctccttcgttgcagaactgatcctgcactccgtaatgttcagtttttacatga
ggtggtgttttg
back to top