S2-RNase, S2-RNase (gene) Prunus webbii

Gene Overview
Name S2-RNase
Gene Symbol S2-RNase
Type gene
Organism Prunus webbii
Synonym S2' S-RNAse
S-RNase
S2 S-RNase
S2'
S-RNAse
Description NA
Comment ribonuclease; PwS2' S-RNAse; self-incompatibility related
ribonuclease; PwS2 S-RNase; self-incompatibility related
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2-RNaseDQ118144.1-S2-RNase.m1Prunus webbiimRNA
S2-RNaseDQ993661.1-S2-RNase.m1Prunus webbiimRNA
S2-RNaseDQ118143.1-S2-RNase.m1Prunus webbiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus webbiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ118144.1-S2-RNase.m1 N/A DQ118144.1
mRNA parsed from NCBI nr database DQ993661.1-S2-RNase.m1 N/A DQ993661.1
mRNA parsed from NCBI nr database DQ118143.1-S2-RNase.m1 N/A DQ118143.1

Sequence(s):
>DQ118144.1-S2-RNase.m1510
gtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaaaccccggccattacaatatttcac
aatccatggcctatggccaagtaattattcaaacccaaggattcccagtaactgcactgggtcgcaatttaagaaacaga
atttgtacccttatttgcaatccgtactgaagaaatcttggccggacgtggaaagtggcaatgatacaaaattttgggaa
ggcgaatggaacaaacatggtacatgttccgaacggacacttaacataatgcaatacttccagcgatcctacgcaatgtg
gaaatcacacaatattacagagatccttcaaaacgcttcaatcgtaccacatccgacacaaacatggaagtactcggaca
tagaatcaccaattaaaacagcaactaaaagaacacctgtccttcgttgcaaacctgatccagcacagaataagagcggg
ccaaagactcagttgttacatgaagtggta
back to top
>DQ993661.1-S2-RNase.m1696
atgttgaaattatcgtcactcgctttcgttgttcttgcttttgcattcttcttgtgtttcattatgagcactggtgatgg
atcttataactattttcaatttgtgcaacaatggccaccggccacttgcatacgtagcacaaaaccttgctccaaacaac
ggtcattaccaattttcaccatccatggcctatggccaagtaattattcaaacccaaagacgcctagtaattgcaacggg
tcgcaatttgacgcaattaagttgtcccctcgattgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaa
tgatgaagggttttgggaaggcgaatggaacaaacatggtaaatgttccgaacagacacttaaccaaatgcaatacttcg
agcgatcccacgaaatgtggatttttcacaatattacgaagatccttaaaaacgcttcaatcgtaccacatccgacaaaa
acatggaagtacacggacatagtatcagccattaaagcactaactcgaacaacacccctccttcgttgcaaacgtaatcc
agcacaggttaagggccagccgcagtttcagttgttacatgaagtggtattgtgtttggagtataaggcattaaaacaga
ttgactgtaatcgaacagcaggatgccggaataatgttgacatcaagtttcaataa
back to top
>DQ118143.1-S2-RNase.m1510
gtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaaaccccggccattacaatatttcac
aatccatggcctatggccaagtaattattcaaacccaaggattcccagtaactgcactgggtcgcaatttaagaaacaga
atttgtacccttatttgcaatccgtactgaagaaatcttggccggacgtggaaagtggcaatgatacaaaattttgggaa
ggcgaatggaacaaacatggtacatgttccgaacggacacttaacataatgcaatacttccagcgatcctacgcaatgtg
gaaatcacacaatattacagagatccttcaaaacgcttcaatcgtaccacatccgacacaaacatggaagtactcggaca
tagaatcaccaattaaaacagcaactaaaagaacacctgtccttcgttgcaaacctgatccagcacagaataagagcggg
ccaaagactcagttgttacatgaagtggta
back to top