S20-RNase, S20-RNase (gene) Malus x domestica

Gene Overview
Name S20-RNase
Gene Symbol S20-RNase
Type gene
Organism Malus x domestica
Synonym S20-ribonuclease
S20-RNase
Description NA
Comment self-incompatibility ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S20-RNaseHQ689397.1-S20-RNaseMalus x domesticagene
S20-RNaseHQ689396.1-S20-RNaseMalus x domesticagene
S20-RNaseHQ689395.1-S20-RNaseMalus x domesticagene
S20-RNaseEU427458.1-S20-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S20-RNaseHQ689397.1-S20-RNase.m1Malus x domesticamRNA
S20-RNaseHQ689396.1-S20-RNase.m1Malus x domesticamRNA
S20-RNaseHQ689395.1-S20-RNase.m1Malus x domesticamRNA
S20-RNaseEU427458.1-S20-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HQ689397.1-S20-RNase N/A HQ689397.1
gene parsed from NCBI nr database HQ689396.1-S20-RNase N/A HQ689396.1
gene parsed from NCBI nr database HQ689395.1-S20-RNase N/A HQ689395.1
gene parsed from NCBI nr database EU427458.1-S20-RNase N/A EU427458.1
mRNA parsed from NCBI nr database HQ689397.1-S20-RNase.m1 N/A HQ689397.1
mRNA parsed from NCBI nr database HQ689396.1-S20-RNase.m1 N/A HQ689396.1
mRNA parsed from NCBI nr database HQ689395.1-S20-RNase.m1 N/A HQ689395.1
mRNA parsed from NCBI nr database EU427458.1-S20-RNase.m1 N/A EU427458.1

Sequence(s):
>HQ689397.1-S20-RNase514
ttttacgcagcaatatcagccggctgtctgccactctaatccaactccttgtaaggatcctcctgacaagttgtttactg
ttcacgggttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatatta
ttagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgctag
agccaccaaatttttaaaccaaatgatgcattatataagtacgctaattaacacttaagtaataattcaatcatcaacat
ctacataatttggttacaaaaaatttaatcttactatcattactctatatttttttgatatatacatatagtcaacacag
gtacaaatattacaattaatttaaaatttaatcataaattatttccgttatatattattatattgtcagataaaaatact
cgaacaccagttggcaattatttggccgaacgta
back to top
>HQ689396.1-S20-RNase514
ttttacgcagcaatatcagccggctgtctgccactctaatccaactccttgtaaggatcctcctgacaagttgtttactg
ttcacgggttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatatta
ttagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgctag
agccnccaaatttttaaaccaaatgatgcattatataagtacgctaattaacacttaagtaataattcaatcatcaacat
ctacataatttggttacaaaaaatttaatcttactatcattactctatatttttttgatatatacatatagtcaacacag
gtacaaatattacaattaatttaaaatttaatcataaattatttccgttatatattattatattgtcagataaaaatact
cgaacaccagttggcaatgatttggccgaacgta
back to top
>HQ689395.1-S20-RNase514
ttttacgcagcaatatcagccggctgtctgccactctaatccaactccttgtaaggatcctcctgacaagttgtttactg
ttcacgggttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatatta
ttagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgctag
agccaccaaatttttaaaccaaatgatgcattatataagtacgctaattaacacttaagtaataattcaatcatcaacat
ctacataatttggttacaaaaaatttaatcttactatcattactctatatttttttgatatatacatatagtcaacacag
gtacaaatattacaattaatttaaaatttaatcataaattatttccgttatatattattatattgtcagataaaaatact
cgaacaccagttggcaatgatttggccgaacgta
back to top
>EU427458.1-S20-RNase511
tttacgcagcaatatcagccggctgtctgccactctaatccaactccttgtaaggatcctcctgacaagttgtttactgt
tcacgggttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatattat
tagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgctaga
gccaccaaatttttaaaccaaatgatgcattatataagtacgctaattaacacttaagtaataattcaatcatcaacatc
tacataatttggttacaaaaaatttaatcttactatcattactctatattttttgatatatacatatagtcaacacaggt
acaaatattacaattaatttaaaatttaatcataaattatttccgttatatattattatattgtcagataaaaatactcg
aacaccagttggcaattatttggccgaacgt
back to top
>HQ689397.1-S20-RNase.m1196
ttttacgcagcaatatcagccggctgtctgccactctaatccaactccttgtaaggatcctcctgacaagttgtttactg
ttcacgggttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgataaaaata
ctcgaacaccagttggcaattatttggccgaacgta
back to top
>HQ689396.1-S20-RNase.m1196
ttttacgcagcaatatcagccggctgtctgccactctaatccaactccttgtaaggatcctcctgacaagttgtttactg
ttcacgggttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgataaaaata
ctcgaacaccagttggcaatgatttggccgaacgta
back to top
>HQ689395.1-S20-RNase.m1196
ttttacgcagcaatatcagccggctgtctgccactctaatccaactccttgtaaggatcctcctgacaagttgtttactg
ttcacgggttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgataaaaata
ctcgaacaccagttggcaatgatttggccgaacgta
back to top
>EU427458.1-S20-RNase.m1194
tttacgcagcaatatcagccggctgtctgccactctaatccaactccttgtaaggatcctcctgacaagttgtttactgt
tcacgggttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgataaaaatac
tcgaacaccagttggcaattatttggccgaacgt
back to top