S22-RNase, S22-RNase (gene) Prunus avium

Gene Overview
Name S22-RNase
Gene Symbol S22-RNase
Type gene
Organism Prunus avium
Synonym S22-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S22-RNaseEF429142.1-S22-RNasePrunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S22-RNaseEF429142.1-S22-RNase.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EF429142.1-S22-RNase N/A EF429142.1
mRNA parsed from NCBI nr database EF429142.1-S22-RNase.m1 N/A EF429142.1

Sequence(s):
>EF429142.1-S22-RNase2867
atgtcgatgttgaaatcgtcactcgcgttccttgttcttgcttttgttttcttcttgtgtttcattatgagcactggtgg
gttgcattacaatctttttctcgttatatcctatacgctaattagcatgaattgcatttttctacttctaatgtttagag
aaatatcatgtgtattagatgatacaggtggcatgcgctgtattgaatcagcccatatttttcatttgatctatcgcata
actttgtttggatgagtaactattttgggaattatttttctgcatggtttctttcgtttactctgaaagttgtaccgata
agtgcagtattcatcattggaagctaaaaatatgttatttatacatcacatacttatttaagataccattaaccttctca
caataattctggcaggatcttatgtctattttcaatttgtgcaacaatggccaccggccacctgcatacgtagcaacaaa
ccttgctccaaacaccggccattacaaattttcaccattcatggcctatggccaagcaattattcaaacccaaagatgcc
cagtacttgcacgggggcgcgatttaactttactaaagtggtatgtattgtttcttttttcacttactatttagcattta
gttctggaaaattagactgtcatttgaaagtcctcaaactcacaagtggaccctaaatttttgtccaatataggtcccta
cattttctatttcctagacatatacccactctataaatctatgtgtaaaatccgatttcaaatttaaataaccagtagga
tataagaggccatagtatttctatgtttttacatcgttgccattagacttcatattttatttataatttatttcaagcat
ttcattaactgccataattgtaattaatactccctattaatggcatatcaatcaccccatttcttttggttgccattccc
tctaacaaatagcccactaaaattgcaaaaaaaaaagaaaaaagcaaattacatatccaataatgtacctatgaaaaata
taaataaataaataaatgtatatatatatattaaatttggaaattggtataaataaaaggaaataaataagctatcaatt
tgaaaattaaaatacgaattgatcaagtagtcaaatttgaaaaaaaaaccgagtatattattggtttttaaaggaacaac
gactagattcaaaccaaacggcagtaattacaccaagctttaattacttttttaaaaaataaggaaaaaactgacccatt
aaatctttggaatctatacaaaattgaaacacaattaatcggcattgaattgtagctaatttcttaaacaaatcacgttt
aaaatgtcattaagggtattataggaatttaaaaaatataacatttaacacattaagcttgattaggaaatttgatgagt
tggatcctagtcattgggttttatttatagaaaaataaaacgatgggttgtaggtaagaaaaaattaatttgaaggggaa
gagtcaaatttactaattttaaaaagtcatcattttaattctcaagctctcaaatcaatcaatatggtgctttatctttg
ggcacatcaatttgatcctattgttgcattatgacaatttttttttattaaatttggtcatatgtcatcacgtaaccaac
tttatagggatattctcattaaaatatagctcgtctgagtcctaaagctcacgtgtttgctcaacagtatcatattctcc
ctatttagggtttcgcattggggtcccattcaaaagagtaaatagccttattgagcaaaagacttgagctttactttgtg
tcatggatggataggttgtattttgatgaaaatatcgcattaaagttggtcacatgtcatacattaccaattttaacgaa
gattttgatggaatggaacgagagggaccaacctgatgtgtgaactagaaaattaaagaccacattgattgatttgaaag
tttgaggactcaattaaatacttttaatttgaaaagttcaagaacccttcgtcataaaaacataaaataaaataaaaacc
aaacaaagttacaaaaaatagtaagaactgaacatattcattaagtaagggtaatatagtaaattactaataataaataa
ataaaacccaattggcaaggggctagtatacttaaagtataaatttgtaatacatttatattcgtatgtatattaatgta
ctatatatttctaataatggatctgctcatctaattaaaggacctgttattttgtacttgcgtatatagtcaaaggatta
tacatagtggaaggattaaaattaatattcaagtttaatttaaaatttttatttgtttgtgttggaattacaaaatatta
ttcaaaaatgaaaattaagcatccctaaatttatttatttttctcagtaccctcaattgcgaaaagatctgaagaaatct
tggcccgacgtggaaagtggcaatgatacaaaattttgggaaggcgaatggaacaaacatggtacgtgttccgaacagac
acttaaccaaatgcaatacttcgagcgatcccacgcaatgtggacctcgttcaacattacaaagatccttaaaaacgctt
caatcgtaccacatccgacacaaacatggacctactcggacatagtatcacccattaaagcagcaactggaagaacaccc
ctccttcgttgcaaaggagatccaaaacagccgaactctcagttgttacatgaagtggtattttgttatgagtttaatgc
gttaaagcagattgactgtaatcgaacagcaggatgctggaataatgttgacatcaagtttcaataa
back to top
>EF429142.1-S22-RNase.m1681
atgtcgatgttgaaatcgtcactcgcgttccttgttcttgcttttgttttcttcttgtgtttcattatgagcactggatc
ttatgtctattttcaatttgtgcaacaatggccaccggccacctgcatacgtagcaacaaaccttgctccaaacaccggc
cattacaaattttcaccattcatggcctatggccaagcaattattcaaacccaaagatgcccagtacttgcacgggggcg
cgatttaactttactaaagtgtaccctcaattgcgaaaagatctgaagaaatcttggcccgacgtggaaagtggcaatga
tacaaaattttgggaaggcgaatggaacaaacatggtacgtgttccgaacagacacttaaccaaatgcaatacttcgagc
gatcccacgcaatgtggacctcgttcaacattacaaagatccttaaaaacgcttcaatcgtaccacatccgacacaaaca
tggacctactcggacatagtatcacccattaaagcagcaactggaagaacacccctccttcgttgcaaaggagatccaaa
acagccgaactctcagttgttacatgaagtggtattttgttatgagtttaatgcgttaaagcagattgactgtaatcgaa
cagcaggatgctggaataatgttgacatcaagtttcaataa
back to top