S23-RNase, S23-RNase (gene) Pyrus x bretschneideri

Gene Overview
Name S23-RNase
Gene Symbol S23-RNase
Type gene
Organism Pyrus x bretschneideri
Synonym NA
Description NA
Comment coding region not yet determined
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S23-RNaseAY250991.1-S23-RNasePyrus x bretschneiderigene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY250991.1-S23-RNase N/A AY250991.1

Sequence(s):
>AY250991.1-S23-RNase335
aaggatcctactgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaa
ggcgccgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgt
gtatctatatttttggataatactaagccaccaaatttttaaatcaaatcatgtgtcatataagtacgttaattaacact
taagtaataattcaatcatcaatatccacatcatttgatgaagccttgagacaccaaaacttacttctggttttctaata
ttaaagattatatat
back to top