S26-RNase, S26-RNase (gene) Malus x domestica

Gene Overview
Name S26-RNase
Gene Symbol S26-RNase
Type gene
Organism Malus x domestica
Synonym S26-RNase
Description NA
Comment self-incompatibility ribonuclease
ribonuclease; stylar self-incompatibility gene product
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S26-RNaseAB428432.1-S26-RNaseMalus x domesticagene
S26-RNaseEU427459.1-S26-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S26-RNaseAF016918.1-S26-RNase.m1Malus x domesticamRNA
S26-RNaseAB428432.1-S26-RNase.m1Malus x domesticamRNA
S26-RNaseEU427459.1-S26-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB428432.1-S26-RNase N/A AB428432.1
gene parsed from NCBI nr database EU427459.1-S26-RNase N/A EU427459.1
mRNA parsed from NCBI nr database AF016918.1-S26-RNase.m1 N/A AF016918.1
mRNA parsed from NCBI nr database AB428432.1-S26-RNase.m1 N/A AB428432.1
mRNA parsed from NCBI nr database EU427459.1-S26-RNase.m1 N/A EU427459.1

Sequence(s):
>AB428432.1-S26-RNase659
caatttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctgacaagttgtttac
ggttcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtgacttctcatatgg
taatattattaataatcagatagtcaatattgtttatttcatatatacatatactgaatgcagatttccatacacgcttg
tgcaaatgttacaattaatttaaaatttaatcataatttttttttttttgtattataaatgttatattatattgtcagct
aaaaaatatccaagcccagttggaaattatttggccgaacgtactcaatcgaacagatcatataggcttctgggaaagac
aatggaaaaaacatggcagctgtgggcgtcccgcaataacgaacgaggtggattactttcaaacagtaatcaaaatgtac
ataacccagaaacaaaatgtatccaaaatcctctcaaaagcgaagattgaaccagaggggcgaatcaggatgctgaagga
tattgaagatgccatacgcaatggtaccaacaataagaaaccaaaactcaagtgccaaaagaatagtaggatgactgaat
tggttgaggtcactctttg
back to top
>EU427459.1-S26-RNase357
tttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctgacaagttgtttacggt
tcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtgacttctcatatggtaa
tattattaataatcagatagtcaatattgtttatttcatatatacatatactgaatgcagatttccatacacgcttgtgc
aaatattacaattaatttaaaatttaatcataatttttttttttgtattataaatgttatattatattgtcagctaaaaa
atatccaagcccagttggaaattatttggccgaacgt
back to top
>AF016918.1-S26-RNase.m1684
atggggattacggggataacatatgtggttacgatggtattttcattaattgtattaatattgtcttcgtacacggcggg
atatgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtg
acttctcatatgctaaaaaatatccaagcccagttggaaattatttggccgaacgtactcaatcgaacagatcatatagg
cttctgggaaagacaatggaaaaaacatggcagctgtgggcgtcccgcaataacgaacgaggtggattactttcaaacag
taatcaaaatgtacataacccagaaacaaaatgtatccaaaatcctctcaaaagcgaagattgaaccagaggggcgaatc
aggatgctgaaggatattgaagatgccatacgcaatggtaccaacaataagaaaccaaaactcaagtgccaaaagaatag
taggatgactgaattggttgaggtcactctttgcagagatagcaacttaacacagttcataaattgccccagcccaattc
taccaggatcaccatttctctgccccgccaatattcggtattaa
back to top
>AB428432.1-S26-RNase.m1500
caatttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctgacaagttgtttac
ggttcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtgacttctcatatgc
taaaaaatatccaagcccagttggaaattatttggccgaacgtactcaatcgaacagatcatataggcttctgggaaaga
caatggaaaaaacatggcagctgtgggcgtcccgcaataacgaacgaggtggattactttcaaacagtaatcaaaatgta
cataacccagaaacaaaatgtatccaaaatcctctcaaaagcgaagattgaaccagaggggcgaatcaggatgctgaagg
atattgaagatgccatacgcaatggtaccaacaataagaaaccaaaactcaagtgccaaaagaatagtaggatgactgaa
ttggttgaggtcactctttg
back to top
>EU427459.1-S26-RNase.m1200
tttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctgacaagttgtttacggt
tcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtgacttctcatatgctaa
aaaatatccaagcccagttggaaattatttggccgaacgt
back to top