S26-RNase, S26-RNase (gene) Pyrus x bretschneideri

Gene Overview
Name S26-RNase
Gene Symbol S26-RNase
Type gene
Organism Pyrus x bretschneideri
Synonym S26-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S26-RNaseAY339396.2-S26-RNasePyrus x bretschneiderigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S26-RNaseEU081888.1-S26-RNase.m1Pyrus x bretschneiderimRNA
S26-RNaseAY339396.2-S26-RNase.m1Pyrus x bretschneiderimRNA
S26-RNaseEU101463.1-S26-RNase.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY339396.2-S26-RNase N/A AY339396.2
mRNA parsed from NCBI nr database EU081888.1-S26-RNase.m1 N/A EU081888.1
mRNA parsed from NCBI nr database AY339396.2-S26-RNase.m1 N/A AY339396.2
mRNA parsed from NCBI nr database EU101463.1-S26-RNase.m1 N/A EU101463.1

Sequence(s):
>AY339396.2-S26-RNase441
atggggattgcggggatgatatatatggttacgatggtatttttattaattgtattaatattgccttcccgtacggtagg
atacgattattttcaatttacgcagcaatatcagctggctgtctgccactttaatcctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagcacaggaaatgacccatcatactgcaagaatacaaccttg
aattctactaaggtaatattattaataattagatggtcaaaattgtttatttcatatatacatatactcaacatagattt
tcatgcatgcgtgtgcaaatattacaattaatttaaaatttaatcataaattttttttattatattatattgtcagatag
caaatctcacagcccagttggaaattatttggccgaacgta
back to top
>EU081888.1-S26-RNase.m1687
atggggattgcggggatgatatatatggttacgatggtatttttattaattgtattaatattgccttcccgtacggtagg
atacgattattttcaatttacgcagcaatatcagctggctgtctgccactttaatcctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagcacaggaaatgacccatcatactgcaagaatacaaccttg
aattctactaagatagcaaatctgacagcccagttggaaattatttggcccaacgtactcgatcgaaccgatcatataac
cttctggaataaacagtggaacaaacatggcagctgtgggcgtcccgcaatacagaacgacatgcattacttgcaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgaaatcctctcaaaggcgaagattgaaccggtggggagattc
tggacacagaaggaaattgaaaaggccatacgcaaaggtaccaacaataaggaaccaaaactcaagtgccaaaagaatgc
tcaggggactgaattggttgaggtcactatttgtagcgatcgcaacttaaagcagttcatagattgcccccgccctattt
taaatggatcacgatactactgcccccccaataatattttgtattaa
back to top
>AY339396.2-S26-RNase.m1297
atggggattgcggggatgatatatatggttacgatggtatttttattaattgtattaatattgccttcccgtacggtagg
atacgattattttcaatttacgcagcaatatcagctggctgtctgccactttaatcctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagcacaggaaatgacccatcatactgcaagaatacaaccttg
aattctactaagatagcaaatctcacagcccagttggaaattatttggccgaacgta
back to top
>EU101463.1-S26-RNase.m1687
atggggattgcggggatgatatatatggttacgatggtatttttattaattgtattaatattgccttcccgtacggtagg
atacgattattttcaatttacgcagcaatatcagctggctgtctgccactttaatcctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagcacaggaaatgacccatcatactgcaagaatacaaccttg
aattctactaagatagcaaatctgacagcccagttggaaattatttggcccaacgtactcgatcgaaccgatcatataac
cttctggaataaacagtggaacaaacatggcagctgtgggcgtcccgcaatacagaacgacatgcattacttgcaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgaaatcctctcaaaggcgaagattgaaccggtggggagattc
tggacacagaaggaaattgaaaaggccatacgcaaaggtaccaacaataaggaaccaaaactcaagtgccaaaagaatgc
tcaggggactgaattggttgaggtcactatttgtagcgatcgcaacttaaagcagttcatagattgcccccgccctattt
taaatggatcacgatactactgccccaccaataatattctgtattaa
back to top