S28-RNase, S28-RNase (gene) Pyrus sinkiangensis

Gene Overview
Name S28-RNase
Gene Symbol S28-RNase
Type gene
Organism Pyrus sinkiangensis
Synonym S28-RNase
Description NA
Comment involved in self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus sinkiangensisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S28-RNaseEF566872.1-S28-RNase.m1Pyrus sinkiangensismRNA
S28-RNaseKX214124.1-S28-RNase.m1Pyrus sinkiangensismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF566872.1-S28-RNase.m1 N/A EF566872.1
mRNA parsed from NCBI nr database KX214124.1-S28-RNase.m1 N/A KX214124.1

Sequence(s):
>EF566872.1-S28-RNase.m1687
atggggattacggggatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccaaggcgca
gcaatacgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaaccctactccttgtaaggattctc
cagacaagttgtttacggttcacggcttgtggccttcaaactcgagtggacctcacccacataattgcacgaatacaacc
gtgaaatctcagacgataagatcactcaaagcccagttggaaattatttggccgaacgtactcaatcgaaacgatcatgt
agggttctggagtagacagtggggcaaacatggcacctgtgcgtctcccgcattgaagagcgacatgcagtactttcaaa
cagtaatcaatatgtacacaacccagaaacaaaacgtctcaagaatcctttcaaaggcgaatattaaaccgaatgggaca
accaaggcactgacagatatccaaaatgccatacgcaatggtaacaacaatacgatgccaaaactcaagtgcaaaaataa
ttctgggatacctgaattggttgaggtcagtttttgcagcgatagcaacttaacacggttcataaattgcccccacccat
ttttaccaggatcaccatatttctgccccggccatgttcagtattaa
back to top
>KX214124.1-S28-RNase.m1687
atggggattacggggatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccaaggcgca
gcaatacgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaaccctactccttgtaaggattctc
cagacaagttgtttacggttcacggcttgtggccttcaaactcgagtggacctcacccacataattgcacgaatacaacc
gtgaaatctcagacgataagatcactcaaagcccagttggaaattatttggccgaacgtactcaatcgaaacgatcatgt
agggttctggagtagacagtggggcaaacatggcacctgtgcgtctcccgcattgaagagcgacatgcagtactttcaaa
cagtaatcaatatgtacacaacccagaaacaaaacgtctcaagaatcctttcaaaggcgaatattaaaccgaatgggaca
accaaggcactgacagatatccaaaatgccatacgcaatggtaacaacaatacgatgccaaaactcaagtgcaaaaataa
ttctgggatacctgaattggttgaggtcagtttttgcagcgatagcaacttaacacggttcataaattgcccccacccat
ttttaccaggatcaccatatttctgccccggccatgttcagtattaa
back to top