S2m-RNase, S2m-RNase (gene) Prunus armeniaca

Gene Overview
Name S2m-RNase
Gene Symbol S2m-RNase
Type gene
Organism Prunus armeniaca
Synonym self-incompatibility RNase S2m
Description NA
Comment S2m-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2m-RNaseEF101908.1-S2m-RNase.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF101908.1-S2m-RNase.m1 N/A EF101908.1

Sequence(s):
>EF101908.1-S2m-RNase.m1189
ttcaccattcatggcctatggccaagtaattattcaaacccaacgatgcctagtaattgcaatgggtcgaaatttgaggc
aaggaaagtgtaccctcgattgcgatccgatctgaagatatcttggccggacgtggaaagtggcaatgacacaaaatttt
gggaaggcgaatggaacaagcacggcaca
back to top