S3-RNase, S3-RNase (gene) Malus x domestica

Gene Overview
Name S3-RNase
Gene Symbol S3-RNase
Type gene
Organism Malus x domestica
Synonym Pink Pearl S3-RNase
S3-RNase precursor
S3-RNase
Description pistil rejection of S3-pollen
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseAB618094.1-S3-RNaseMalus x domesticagene
S3-RNaseAB428425.1-S3-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseAB618094.1-S3-RNase.m1Malus x domesticamRNA
S3-RNaseU12200.1-S3-RNase.m1Malus x domesticamRNA
S3-RNaseAB428425.1-S3-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AB618094.1-S3-RNase Chr17:31239422..31240822
unanchored:31130188..31131591
AB618094.1
predicted genes from whole genome assembly AB428425.1-S3-RNase Chr17:31239087..31240877
unanchored:31129853..31131646
AB428425.1
mRNA parsed from NCBI nr database AB618094.1-S3-RNase.m1 N/A AB618094.1
predicted genes from whole genome assembly U12200.1-S3-RNase.m1 Chr17:31238993..31240970
unanchored:31129759..31131739
U12200.1
predicted genes from whole genome assembly AB428425.1-S3-RNase.m1 Chr17:31239087..31240877
unanchored:31129853..31131646
AB428425.1

Sequence(s):
>AB618094.1-S3-RNase1399
aggatcctcctgacaagttgtttacggttcatggtttgtggccttcaaatgttaatggaagtgaccccaagaaatgcaaa
actacaatcttgaaccctcaaacggtaatattattcaggcaaaattaatatccagtacttagttataatgttcattaatt
aagaccttattagttttcagattttgatcgatgtccctagcaaattcaaatgtcaattacataatatttttaaataaaaa
ttagtaattgaaacttacacccttattaatgaataagtttgtacccattaattttcaattcaaaacttacatccttatta
aactcctaactaattttcaattcaaaacatttccaaaaactaaaaattagaataagtttgtacccattaattttttataa
aatgattttcaattttttaatcttaaatgtagccattcatataatcctacatttacccattcttaaatataccattttgt
tatgtaaaatgtaccctttttaaaatataaatgtaacccttgtttatataaaatacattcaattttttttttctaaacca
tatattttaaattatccatttttaatataaaacgtaaccattttttatattaaatcaattcaaatttttttttcgaatcc
attttttaaacttatatgggtacattctatttcgttgatttgagagtctatcgataccaagtttaatggaagaaatttaa
taatgtaagcctaatacctcttttttttctttcaaaaatctacctatgtttgatacaataattttttgttagttttaatg
aacgtacccatgttttcttatatatatatatatatatatgcatgcatgtatgtatgtatatatatatataacatattgga
gggcataaaaaggtcgtacccagtgcacaaggctcccgctttacgcagggtctgggagaagtgaatgtcggctagcctta
cccccatttatggagaggctgctcccaagtctcgaacccgagacctaccgctcatgggcgaaggcacttgccataattta
ctttaaattttttaatcctataaatggattttatttaaaatctcattgatataaacaaccataaattttaatttttcatt
taaaattataataatctacataaaaatacattattatattaatgtcagaaactttgatcaaaaactgaaaatgagtaaga
tttcaattaaagaacattgattattagtactgtgtccaaaatctccctattattcataattagatggtcaaattgtttat
cttttcatatatacacatgctcgacatagattttcatgcactcgtgaaagatattactattaatttaaaatttaatcata
attttttttttctattataatattgtatgtcagataaca
back to top
>AB428425.1-S3-RNase1790
caatttacgcagcaatatcagccggctgtctgcagctctaatcctactccttgtaaggatcctcctgacaagttgtttac
ggttcatggtttgtggccttcaaatgttaatggaagtgaccccaagaaatgcaaaactacaatcttgaaccctcaaacgg
taatattattcaggcaaaattaatatccagtacttagttataatgttcattaattaagaccttattagttttcagatttt
gatcgatgtccctagcaaattcaaatgtcaattacataatatttttaaataaaaattagtaattgaaacttacaccctta
ttaatgaataagtttgtacccattaattttcaattcaaaacttacatccttattaaactcctaactaattttcaatttaa
aacatttccaaaaactaaaaattagaataagtttgtacccattaattttttataaaatgattttcaattttttaatctta
aatgtagccattcatataatcctacatttacccattcttaaatataccattttgttatgtaaaatgtaccctttttaaaa
tataaatgtaacccttgtttatataaaatacattcaattttttttttctaaaccatatattttaaattatccatttttaa
tataaaacgtaaccattttttatattaaatcaattcaaatttttttttcgaatccattttttaaacttatatgggtacat
tctatttcgttgatttgagagtctatcgataccaagtttaatggaagaaatttaataatgtaagcctaatacctcttttt
tttctttcaaaaatctacctatgtttgatacaataattttttgttagttttaatgaacgtacccatgttttcttatatat
atatatatatatatgcatgcatgtatgtatgtatatatatatataacatattggagggcataaaaaggtcgtacccagtg
cacaaggctcccgctttacgcagggtctgggagaagtgaatgtcggctagccttacccccatttatggagaggctgctcc
caagtctcgaacccgagacctaccgctcatgggcgaaggcacttgccataatttactttaaattttttaatcctataaat
ggattttatttaaaatctcattgatataaacaaccataaattttaatttttcatttaaaattataataatctacataaaa
atacattattatattaatgtcagaaactttgatcaaaaactgaaaatgagtaagatttcaattaaagaacattgattatt
agtactgtgtccaaaatctccctattattcataattagatggtcaaattgtttatcttttcatatatacacatgctcgac
atagattttcatgcactcgtgaaagatattactattaatttaaaatttaatcataattttttttttctattataatattg
tattgtcagataacaaatcttacagcccagctggaaattatttggccaaacgtactcaatcgaaaggctcatgcacgctt
ctggcgtaaacagtggcgtaaacatggcacctgtgggtaccccacaatagcggacgacatgcattactttagcacagtaa
tcgaaatgtacataaccaagaaacaaaatgtctctgaaatcctctcaaaggcgaaaattaaaccggagaagaaattcagg
acacgggacgacattgtgaatgccataagccaaagtatcgactataagaaaccaaaactcaagtgcaagaacaataatca
gataactgaattggttgaggtcggtctttg
back to top
>AB618094.1-S3-RNase.m1110
aggatcctcctgacaagttgtttacggttcatggtttgtggccttcaaatgttaatggaagtgaccccaagaaatgcaaa
actacaatcttgaaccctcaaacgataaca
back to top
>U12200.1-S3-RNase.m1687
atggggattacagggatgatatatatggttacaatggtattttcattaattgtattaatattgtcttcgtccgcggtgaa
attcgattattttcaatttacgcagcaatatcagccggctgtctgcagctctaatcctactccttgtaaggatcctcctg
acaagttgtttacggttcatggtttgtggccttcaaatgttaatggaagtgaccccaagaaatgcaaaactacaatcttg
aaccctcaaacgataacaaatcttacagcccagctggaaattatttggccaaacgtactcaatcgaaaggctcatgcacg
cttctggcgtaaacagtggcgtaaacatggcacctgtgggtaccccacaatagcggacgacatgcattactttagcacag
taatcgaaatgtacataaccaagaaacaaaatgtctctgaaatcctctcaaaggcgaaaattaaaccggagaagaaattc
aggacacgggacgacattgtgaatgccataagccaaagtatcgactataagaaaccaaaactcaagtgcaagaacaataa
tcagataactgaattggttgaggtcggtctttgcagcgataacaacttaacgcagttcatagattgcccccgcccatttc
cacaaggatcaccatttttctgccccaccaataatattcagtattaa
back to top
>AB428425.1-S3-RNase.m1500
caatttacgcagcaatatcagccggctgtctgcagctctaatcctactccttgtaaggatcctcctgacaagttgtttac
ggttcatggtttgtggccttcaaatgttaatggaagtgaccccaagaaatgcaaaactacaatcttgaaccctcaaacga
taacaaatcttacagcccagctggaaattatttggccaaacgtactcaatcgaaaggctcatgcacgcttctggcgtaaa
cagtggcgtaaacatggcacctgtgggtaccccacaatagcggacgacatgcattactttagcacagtaatcgaaatgta
cataaccaagaaacaaaatgtctctgaaatcctctcaaaggcgaaaattaaaccggagaagaaattcaggacacgggacg
acattgtgaatgccataagccaaagtatcgactataagaaaccaaaactcaagtgcaagaacaataatcagataactgaa
ttggttgaggtcggtctttg
back to top