S3-RNase, S3-RNase (gene) Prunus avium

Gene Overview
Name S3-RNase
Gene Symbol S3-RNase
Type gene
Organism Prunus avium
Synonym RNase S3
S3-ribonuclease
S3-RNase
Description self-incompatibility
Comment S3-RNase
ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseKJ590777.1-S3-RNasePrunus aviumgene
S3-RNaseJQ280530.1-S3-RNasePrunus aviumgene
S3-RNaseJQ280520.1-S3-RNasePrunus aviumgene
S3-RNaseAY571663.1-S3-RNasePrunus aviumgene
S3-RNaseAB075595.1-S3-RNasePrunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseKJ590777.1-S3-RNase.m1Prunus aviummRNA
S3-RNaseJQ280530.1-S3-RNase.m1Prunus aviummRNA
S3-RNaseJQ280520.1-S3-RNase.m1Prunus aviummRNA
S3-RNaseAY571663.1-S3-RNase.m1Prunus aviummRNA
S3-RNaseAJ298312.1-S3-RNase.m1Prunus aviummRNA
S3-RNaseAY851456.1-S3-RNase.m1Prunus aviummRNA
S3-RNaseAB031816.1-S3-RNase.m1Prunus aviummRNA
S3-RNaseAB010306.1-S3-RNase.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KJ590777.1-S3-RNase N/A KJ590777.1
gene parsed from NCBI nr database JQ280530.1-S3-RNase N/A JQ280530.1
gene parsed from NCBI nr database JQ280520.1-S3-RNase N/A JQ280520.1
gene parsed from NCBI nr database AY571663.1-S3-RNase N/A AY571663.1
gene parsed from NCBI nr database AB075595.1-S3-RNase N/A AB075595.1
mRNA parsed from NCBI nr database KJ590777.1-S3-RNase.m1 N/A KJ590777.1
mRNA parsed from NCBI nr database JQ280530.1-S3-RNase.m1 N/A JQ280530.1
mRNA parsed from NCBI nr database JQ280520.1-S3-RNase.m1 N/A JQ280520.1
mRNA parsed from NCBI nr database AY571663.1-S3-RNase.m1 N/A AY571663.1
mRNA parsed from NCBI nr database AJ298312.1-S3-RNase.m1 N/A AJ298312.1
mRNA parsed from NCBI nr database AY851456.1-S3-RNase.m1 N/A AY851456.1
mRNA parsed from NCBI nr database AB031816.1-S3-RNase.m1 N/A AB031816.1
mRNA parsed from NCBI nr database AB010306.1-S3-RNase.m1 N/A AB010306.1

Sequence(s):
>KJ590777.1-S3-RNase366
tggccgaacgttgtaagtagcaacgatacaaaattttgggaaagtgaatggaacaaacatggtacttgttccgaacagac
acttaaccaagtgcaatacttcgagatatcccacgaaatgtggaactcgttcaatattacagatatccttaaaaacgctt
caatcgtaccacatccgacacaaacatggaagtactcggacatagtatcagccattcagagtaaaactcaaagaacaccc
ctccttcgttgcaaaacggatccagcacatcctaacgcgaatactcagttgttacatgaagtggtattttgttatggata
taatgcaataaagcagattgattgtaatcgaacagcaggatgcaaa
back to top
>JQ280530.1-S3-RNase843
caacgatgcccagtaattgcaatgggtcgcgatttaagaaagagctattggtaggtattgtttcttttgttttgttttgt
tttttttttttctccatttacccttaagcatttagtttttaggaaattagtttgtcacctgaagataatatgcttttttt
caataaaccttgcgagttggataaaattttgatgttagttatgtgattaggcacattattttgattgtatacataaggac
agaatacaaatgagcaatgctaggcatatcacatttacaaatgtagtatgactagcattttttattacaaatatatgtat
attagtagatatattaatgtacataatttcaaccatcatataagatggtataaaattgtggtaaaaatagcagtggtacc
taataaaatggtaaaaattaaaattcaatttaataatcaggttataaatgagaaaagatgaaaatcttcgctaacgtttt
gactttttttttcttctcaaaatatggctatattgcgtggatgtccagtcccctcgaatgcaatccaaactgaagatatc
ttggccgaacgttgtaagtagcaacgatacaaaattttgggaaagtgaatggaacaaacatggtacttgttccgaacaga
cacttaaccaagtgcaatacttcgagatatcccacgaaatgtggaactcgttcaatattacagatatccttaaaaacgct
tcaatcgtaccacatccgacacaaacatggaagtactcggacatagtatcagccattcagagtaaaactcaaagaacacc
cctccttcgttgcaaaacggatccagcacatcctaacgcgaat
back to top
>JQ280520.1-S3-RNase253
ttgtgtttcattatcagcgctggtgatggtgggttgccttacaatcttttgctctatatatcctatatgcatataatcag
cattgcgtttttctacttgtattttttgttcagagaaactatattgtgtgtgttgcaataagtgcagtctattcatcaca
ataattttcgcaggatcttatgtctattttcaatttgtgcaacaatggccaccgaccacctgcagagttcagaagaaatg
ctctaaaccccgg
back to top
>AY571663.1-S3-RNase1311
atggctatgttgaaatcgtcactctctttccttgttcttggttttgctttcttcttgtgtttcattatcagcgctggtga
tggtgggttgccttacaatcttttgctctatatatcctatatgcatataatcagcattgcgtttttctacttgtattttt
tgttcagagaaactatattgtgtgtgttgcaataagtgcagtctattcatcacaataattttcgcaggatcttatgtcta
ttttcaatttgtgcaacaatggccaccgaccacctgcagagtacagaagaaatgctctaaaccccggccattacaaaact
tcaccattcatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcgcgatttaagaaa
gagctattggtaggtattgtttcttttgttttgttttgtttttttttttctccatttacccttaagcatttagtttttag
gaaattagtttgtcacctgaagataatatgctttttttcaataaaccttgcgagttggataaaattttgatgttagttat
gtgattaggcacattattttgattgtatacataaggacagaatacaaatgagcaatgctaggcatatcacatttacaaat
gtagtatgactagcattttttattacaaatatatgtatattagtagatatattaatgtacataatttcaaccatcatata
agatggtataaaattgtggtaaaaatagcagtggtacctaataaatggtaaaaattaaaattcaatttaataatcaggtt
ataaatgagaaaagatgaaaatcttcgctaacgttttgactttttttttcttctcaaaatatggctatattgcgtggatg
tccagtcccctcgaatgcaatccaaactgaagatatcttggccgaacgttgtaagtagcaacgatacaaaattttgggaa
agtgaatggaacaaacatggtacttgttccgaacagacacttaaccaagtgcaatacttcgagatatcccacgaaatgtg
gaactcgttcaatattacagatatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggaagtactcggaca
tagtatcagccattcagagtaaaactcaaagaacacccctccttcgttgcaaaacggatccagcacatcctaacgcgaat
actcagttgttacatgaagtggtattttgttatggatataatgcaataaagcagattgattgtaatcgaacagcaggatg
caaaaatcaagttaacatcttgtttccataa
back to top
>AB075595.1-S3-RNase7
tatataa
back to top
>KJ590777.1-S3-RNase.m1366
tggccgaacgttgtaagtagcaacgatacaaaattttgggaaagtgaatggaacaaacatggtacttgttccgaacagac
acttaaccaagtgcaatacttcgagatatcccacgaaatgtggaactcgttcaatattacagatatccttaaaaacgctt
caatcgtaccacatccgacacaaacatggaagtactcggacatagtatcagccattcagagtaaaactcaaagaacaccc
ctccttcgttgcaaaacggatccagcacatcctaacgcgaatactcagttgttacatgaagtggtattttgttatggata
taatgcaataaagcagattgattgtaatcgaacagcaggatgcaaa
back to top
>JQ280530.1-S3-RNase.m1365
caacgatgcccagtaattgcaatgggtcgcgatttaagaaagagctattgtcccctcgaatgcaatccaaactgaagata
tcttggccgaacgttgtaagtagcaacgatacaaaattttgggaaagtgaatggaacaaacatggtacttgttccgaaca
gacacttaaccaagtgcaatacttcgagatatcccacgaaatgtggaactcgttcaatattacagatatccttaaaaacg
cttcaatcgtaccacatccgacacaaacatggaagtactcggacatagtatcagccattcagagtaaaactcaaagaaca
cccctccttcgttgcaaaacggatccagcacatcctaacgcgaat
back to top
>JQ280520.1-S3-RNase.m1108
ttgtgtttcattatcagcgctggtgatggatcttatgtctattttcaatttgtgcaacaatggccaccgaccacctgcag
agttcagaagaaatgctctaaaccccgg
back to top
>AY571663.1-S3-RNase.m1690
atggctatgttgaaatcgtcactctctttccttgttcttggttttgctttcttcttgtgtttcattatcagcgctggtga
tggatcttatgtctattttcaatttgtgcaacaatggccaccgaccacctgcagagtacagaagaaatgctctaaacccc
ggccattacaaaacttcaccattcatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatggg
tcgcgatttaagaaagagctattgtcccctcgaatgcaatccaaactgaagatatcttggccgaacgttgtaagtagcaa
cgatacaaaattttgggaaagtgaatggaacaaacatggtacttgttccgaacagacacttaaccaagtgcaatacttcg
agatatcccacgaaatgtggaactcgttcaatattacagatatccttaaaaacgcttcaatcgtaccacatccgacacaa
acatggaagtactcggacatagtatcagccattcagagtaaaactcaaagaacacccctccttcgttgcaaaacggatcc
agcacatcctaacgcgaatactcagttgttacatgaagtggtattttgttatggatataatgcaataaagcagattgatt
gtaatcgaacagcaggatgcaaaaatcaagttaacatcttgtttccataa
back to top
>AJ298312.1-S3-RNase.m1690
atggctatgttgaaatcgtcactctctttccttgttcttggttttgctttcttcttgtgtttcattatcagcgctggtga
tggatcttatgtctattttcaatttgtgcaacaatggccaccgaccacctgcagagttcagaagaaatgctctaaacccc
ggccattacaaaacttcaccattcatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatggg
tcgcgatttaagaaagagctattgtcccctcgaatgcaatccaaactgaagatatcttggccgaacgttgtaagtagcaa
cgatacaaaattttgggaaagtgaatggaacaaacatggtacttgttccgaacagacacttaaccaagtgcaatacttcg
agatatcccacgaaatgtggaactcgttcaatattacagatatccttaaaaacgcttcaatcgtaccacatccgacacaa
acatggaagtactcggacatagtatcagccattcagagtaaaactcaaagaacacccctccttcgttgcaaaacggatcc
agcacatcctaacgcgaatactcagttgttacatgaagtggtattttgttatggatataatgcaataaagcagattgatt
gtaatcgaacagcaggatgcaaaaatcaagttaacatcttgtttccataa
back to top
>AY851456.1-S3-RNase.m1284
ctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcgcgatttaagaaagagctattgtcccc
tcgaatgcaatccaaactgaagatatcttggccgaacgttgtaagtagcaacgatacaaaattttgggaaagtgaatgga
acaaacatggtacttgttccgaacagacacttaaccaagtgcaatacttcgagatatcccacgaaatgtggaactcgttc
aatattacagatatccttaaaaacgcttcaatcgtaccacatcc
back to top
>AB031816.1-S3-RNase.m1398
ttgtgtttcattatcagcgctggtgatggatcttatgtctattttcaatttgtgcaacaatggccaccgaccacctgcag
agttcagaagaaatgctctaaaccccggccattacaaaacttcaccattcatggcctatggccaagtaattattcaaacc
caacgatgcccagtaattgcaatgggtcgcgatttaagaaagagctattgtcccctcgaatgcaatccaaactgaagata
tcttggccgaacgttgtaagtagcaacgatacaaaattttgggaaagtgaatggaacaaacatggtacttgttccgaaca
gacacttaaccaagtgcaatacttcgagatatcccacgaaatgtggaactcgttcaatattacagatatccttaaaaa
back to top
>AB010306.1-S3-RNase.m1690
atggctatgttgaaatcgtcactctctttccttgttcttggttttgctttcttcttgtgtttcattatcagcgctggtga
tggatcttatgtctattttcaatttgtgcaacaatggccaccgaccacctgcagagttcagaagaaatgctctaaacccc
ggccattacaaaacttcaccattcatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatggg
tcgcgatttaagaaagagctattgtcccctcgaatgcaatccaaactgaagatatcttggccgaacgttgtaagtagcaa
cgatacaaaattttgggaaagtgaatggaacaaacatggtacttgttccgaacagacacttaaccaagtgcaatacttcg
agatatcccacgaaatgtggaactcgttcaatattacagatatccttaaaaacgcttcaatcgtaccacatccgacacaa
acatggaagtactcggacatagtatcagccattcagagtaaaactcaaagaacacccctccttcgttgcaaaacggatcc
agcacatcctaacgcgaatactcagttgttacatgaagtggtattttgttatggatataatgcaataaagcagattgatt
gtaatcgaacagcaggatgcaaaaatcaagttaacatcttgtttccataa
back to top