S3-RNase, S3-RNase (gene) Prunus mume

Gene Overview
Name S3-RNase
Gene Symbol S3-RNase
Type gene
Organism Prunus mume
Synonym S3-RNase
S-RNase
MSRN-3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseAB376969.1-S3-RNasePrunus mumegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseAB376969.1-S3-RNase.m1Prunus mumemRNA
S3-RNaseAB047102.1-S3-RNase.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus mumegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB376969.1-S3-RNase N/A AB376969.1
mRNA parsed from NCBI nr database AB376969.1-S3-RNase.m1 N/A AB376969.1
mRNA parsed from NCBI nr database AB047102.1-S3-RNase.m1 N/A AB047102.1

Sequence(s):
>AB376969.1-S3-RNase1439
atggcaatgttgaaatcgtcactcgctttccttgttcttgcttttgccttcttcttttgttacgttatgagcagtggtgg
gttgcattacatatttttccctttatatcctatatgcatataatcagcgttgcgtttttctacttgtattttttgttcag
agaaactattgtgtgtgttggatgatatatcacatggcatgcggtgtattgaattcacccacatatttttcatttaatgt
aatgcacaactttctttggatgagtaagtatgggattgctttccttatgtcctctttttattttcatcgtcttttgttta
tttgtgataaatgttgcaataagtcagtctattcatcacaataattttggcaggatcttatgactattttcaatttgtgc
aacaatggccgccgaccaactgcagagctcgcaggagaccttgctctaaaccccggccattacaaaacttcaccatccat
ggcctatggccaagtaattactcaaacccaacgatgcccagtaattgcaaagggtcacaatttgaggcaaggaaagtggt
atgtattgtttctttttttctttagcatttagtttttttagaaaattagactctcatatgaggagaatatactaaccttg
ggtgctagataaaattttaacttggtcctctgttgggcaaattaatctgattatacacctaaactataaaattgtaaata
catttatattcgtaggtgtattaatgtaataatggataaaggacctatattcaaaataaaatattgtaatgatgggatta
aaatcaaaaggaaatttaatagccaatgagttcccaccacaatggtagtggctttccccttccccatgacacccgaaccc
gaactccaatgtaaccaaaaaaagaagaagggaatttaatactcggtttgatgaacaaaacaataatcttattcaaaaat
gaaaattgatgtatccctaaatttttgaatttttctcaaaatatgtatattttgtttggatgtatcagtaccctcaattg
caatccaatctgaagatagcttggcccgacgtggaaagtggcaatgatacaaggttttgggaaggcgaatggaacaaaca
tggtagatgttccgaacagacacttaacctaatgcaatatttcgagcgatcctatggaatgtggaaatcctataatatta
cagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacttacgcggacatagtatcacccattaaa
acagcaactaaaagaacacccctccttcgttgcagacaggataagaatactcagtggttacatgaagtggtattttgtta
tgaatatcatgcgttaaagcagattgactgtaatcgaacagcaggatgccaaaatcaaccaaccatctcgtttcaataa
back to top
>AB376969.1-S3-RNase.m1672
atggcaatgttgaaatcgtcactcgctttccttgttcttgcttttgccttcttcttttgttacgttatgagcagtggatc
ttatgactattttcaatttgtgcaacaatggccgccgaccaactgcagagctcgcaggagaccttgctctaaaccccggc
cattacaaaacttcaccatccatggcctatggccaagtaattactcaaacccaacgatgcccagtaattgcaaagggtca
caatttgaggcaaggaaagtgtaccctcaattgcaatccaatctgaagatagcttggcccgacgtggaaagtggcaatga
tacaaggttttgggaaggcgaatggaacaaacatggtagatgttccgaacagacacttaacctaatgcaatatttcgagc
gatcctatggaatgtggaaatcctataatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaaca
tggacttacgcggacatagtatcacccattaaaacagcaactaaaagaacacccctccttcgttgcagacaggataagaa
tactcagtggttacatgaagtggtattttgttatgaatatcatgcgttaaagcagattgactgtaatcgaacagcaggat
gccaaaatcaaccaaccatctcgtttcaataa
back to top
>AB047102.1-S3-RNase.m1544
ggttttgctttcttcttttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaatggccgccgac
caactgcagagctcgcaggagaccttgctctaaaccccggccattacaaaacttcaccatccatggcctatggccaagta
attactcaaacccaacgatgcccagtaattgcaaagggtcacaatttgaggcaaggaaagtgtaccctcaattgcaatcc
aatctgaagatagcttggcccgacgtggaaagtggcaatgatacaaggttttgggaaggcgaatggaacaaacatggtag
atgttccgaacagacacttaacctaatgcaatatttcgagcgatcctatggaatgtggaaatcctataatattacagaga
tccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacttacgcggacatagtatcacccattaaaacagca
actaaaagaacacccctccttcgttgcagacaggataagaatactcagttgttacatgaagtgg
back to top