S3-RNase, S3-RNase (gene) Pyrus pyrifolia

Gene Overview
Name S3-RNase
Gene Symbol S3-RNase
Type gene
Organism Pyrus pyrifolia
Synonym S3-RNase
Description self-incompatibility
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseAB025421.1-S3-RNasePyrus pyrifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseAB025421.1-S3-RNase.m1Pyrus pyrifoliamRNA
S3-RNaseAB002140.1-S3-RNase.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB025421.1-S3-RNase N/A AB025421.1
mRNA parsed from NCBI nr database AB025421.1-S3-RNase.m1 N/A AB025421.1
mRNA parsed from NCBI nr database AB002140.1-S3-RNase.m1 N/A AB002140.1

Sequence(s):
>AB025421.1-S3-RNase684
ctagggattacggggatggtacatgtggttatgatggtatttttattaattgtgttaatattgtgttcgtccacggtggg
atacgattattttcaatttacgcagcaatatcagctggctgtctgcaactctaatcgtactctttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacatggtaggacctgacccaagtaaatgcccgataaagaatatt
cggaagagagaaaaattactcgaacaccagctggaaattatttggccgaacgtattcgatcgaacaaaaaataacctctt
ctgggataaagagtggatgaaacatggctcctgtgggtatcccacaatagataacgagaaccattactttgaaaccgtaa
tcaaaatgtacatcagcaagaaacaaaacgtctctagaatcctctcaaaggcgaagattgaaccggacgggaaaaaaaga
gcactgttggatattgaaaatgccatacgcaatggtgccgacaataagaaaccaaaactcaagtgccaaaagaagggtac
gacgactgaattagttgagatcactctttgcagtgacaaaagcggagaacatttcatagattgcccccacccctttgaac
caatatcaccacattattgccccaccaacaatatcaagtattaa
back to top
>AB025421.1-S3-RNase.m1684
ctagggattacggggatggtacatgtggttatgatggtatttttattaattgtgttaatattgtgttcgtccacggtggg
atacgattattttcaatttacgcagcaatatcagctggctgtctgcaactctaatcgtactctttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacatggtaggacctgacccaagtaaatgcccgataaagaatatt
cggaagagagaaaaattactcgaacaccagctggaaattatttggccgaacgtattcgatcgaacaaaaaataacctctt
ctgggataaagagtggatgaaacatggctcctgtgggtatcccacaatagataacgagaaccattactttgaaaccgtaa
tcaaaatgtacatcagcaagaaacaaaacgtctctagaatcctctcaaaggcgaagattgaaccggacgggaaaaaaaga
gcactgttggatattgaaaatgccatacgcaatggtgccgacaataagaaaccaaaactcaagtgccaaaagaagggtac
gacgactgaattagttgagatcactctttgcagtgacaaaagcggagaacatttcatagattgcccccacccctttgaac
caatatcaccacattattgccccaccaacaatatcaagtattaa
back to top
>AB002140.1-S3-RNase.m1669
atggtacatgtggttatgatggtatttttattaattgtgttaatattgtgttcgtccacggtgggatacgattattttca
atttacgcagcaatatcagctggctgtctgcaactctaatcgtactctttgtaaggatcctcctgacaagttgtttacgg
ttcacggtttgtggccttcaaacatggtaggacctgacccaagtaaatgcccgataaagaatattcggaagagagaaaaa
ttactcgaacaccagctggaaattatttggccgaacgtattcgatcgaacaaaaaataacctcttctgggataaagagtg
gatgaaacatggctcctgtgggtatcccacaatagataatgagaaccattactttgaaaccgtaatcaaaatgtacatca
gcaagaaacaaaacgtctctagaatcctctcaaaggcgaagattgaaccggacgggaaaaaaagagcactgttggatatt
gaaaatgccatacgcaatggtgccgacaataagaaaccaaaactcaagtgccaaaagaagggtacgacgactgaattagt
tgagatcactctttgcagtgacaaaagcggagaacatttcatagattgcccccacccctttgaaccaatatcaccacatt
attgccccaccaacaatatcaagtattaa
back to top