S30-RNase, S30-RNase (gene) Pyrus ussuriensis

Gene Overview
Name S30-RNase
Gene Symbol S30-RNase
Type gene
Organism Pyrus ussuriensis
Synonym S30-RNase
Description NA
Comment glycoprotein
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S30-RNaseAY876945.1-S30-RNasePyrus ussuriensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S30-RNaseAY876945.1-S30-RNase.m1Pyrus ussuriensismRNA
S30-RNaseEF643641.1-S30-RNase.m1Pyrus ussuriensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus ussuriensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY876945.1-S30-RNase N/A AY876945.1
mRNA parsed from NCBI nr database AY876945.1-S30-RNase.m1 N/A AY876945.1
mRNA parsed from NCBI nr database EF643641.1-S30-RNase.m1 N/A EF643641.1

Sequence(s):
>AY876945.1-S30-RNase309
tttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctgacaagttgtttacggt
tcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtgacttctcatatggtaa
tattattaataatcagatagtcaatattgtttatttcatatatacatgtatactgaacacggattttcatacacggttgt
gcaaatattacaattatattgtcaggtaaaaaatatccaagcccagttggaaattatttggccgaacgt
back to top
>AY876945.1-S30-RNase.m1200
tttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctgacaagttgtttacggt
tcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtgacttctcatatggtaa
aaaatatccaagcccagttggaaattatttggccgaacgt
back to top
>EF643641.1-S30-RNase.m1684
atggggattacggggataacatgggtggctatgatggcattttcattaattgtattaatattgtcttcgtacacggcggg
atacgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtg
acttctcatatggtaaaaaatatccaagcccagttggaaattatttggccgaacgtactcaatcgaaccgatcatatagg
cttctgggatagacagtggaaaaaacatggcagctgtgggcgtcccgcaataacgaacgaggtgaattactttcaaacag
taatcaaaatgtacataacccagaaacaaaatgtctccaaaatcctcgcaaaagcgcagattgaaccggaggggagaatc
aggatgctgaaggatattgaagatgccatacgcaatggtaccaacaataagaaaccaaaactcaagtgccaaaagaatgg
taggataactgaattggttgaggtcactctttgcagcgatagcaacttaacacagttcataaattgccccagcccaattc
taccaggatcaccatttctctgccccgccaatattcggtattaa
back to top