S33-RNase, S33-RNase (gene) Pyrus ussuriensis

Gene Overview
Name S33-RNase
Gene Symbol S33-RNase
Type gene
Organism Pyrus ussuriensis
Synonym S33-RNase
Description NA
Comment self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus ussuriensisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S33-RNaseDQ138081.1-S33-RNase.m1Pyrus ussuriensismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ138081.1-S33-RNase.m1 N/A DQ138081.1

Sequence(s):
>DQ138081.1-S33-RNase.m1156
tttacgcagcaatatccgccggctgtctgcaactctaaccctactccttgtaaggatcctcctgacaagttgtttaccgt
tcacggtttgtggccttcaaacgacgtaggagatgacccaatatactgcaagaataaaaccattaaatctcagcag
back to top