S34-RNase, S34-RNase (gene) Malus x domestica

Gene Overview
Name S34-RNase
Gene Symbol S34-RNase
Type gene
Organism Malus x domestica
Synonym S34-RNase
Description NA
Comment nucleoporin; controls self-incompatibility; coding region not determined
Sad5-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S34-RNaseAB540122.1-S34-RNaseMalus x domesticagene
S34-RNaseEU310474.1-S34-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S34-RNaseAB540122.1-S34-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB540122.1-S34-RNase N/A AB540122.1
gene parsed from NCBI nr database EU310474.1-S34-RNase N/A EU310474.1
mRNA parsed from NCBI nr database AB540122.1-S34-RNase.m1 N/A AB540122.1

Sequence(s):
>AB540122.1-S34-RNase1505
atggggattacgaggatgatatatgtggttacgatggtattttcattaattgcattaatattgtcttcgtccncgatggg
atacgattattttcaatttacgcagcaatatcagccggcagtctgcaactctaatcctactccttgtaaggatcctactg
agaaattgtttacggttcacggtttgtggccttcaaactctaatggacctgacccggtaaactgcaagccaaaaaccaag
gtgcctcaggcgcagcagccggtaatatatctgaaaattgaactttccccctctaaagacattttttctagcctataacc
catcatatcatatttatcgcaataagacccaataatcagaatccaactaaacaacttaccaaattagtttgtgtgtcatt
tttttgtattttttaaatctgtaatatgccctcatctaagccagtatggaaagctcttgtaattacgttttaattgatgg
catgcatccaatttggcaaggtattgtagccacgaaatctagttctaaatgtaggaattaatttggaaatatttttcatt
tcaacaataaatttcaatttgaatatacctaattttagggtttaatttcaacaatatatattgtttaattttataaaaat
aacatagctacaatgaaacttacctacggtttatatttttttatgaaaaataatgtacctatctttgaatttttacaaag
ttaatgtatctgcttttttaatttttaacaaaactaatttaactacttccctttatagtattagtatacataatatgtag
aacatatgtccgtatatatttgatctaattcagttttggattgggggagttcacacaaaattaaaatatattaaacaaac
taaatgtctgaaaaaatttataagagatatggtggcctgattttataaataaacacaaattcatggacatcttttttcaa
catgacatcttattcaaattttgagtcttatttagaagtcatcatacatgtgggcttttgtctagaagttatcataaatt
tttttattgtatattttattttgtcagatagatgcatcactcaaaccccagttggaaattatttggccgaacgtactcaa
tcgagccgataatgaaagcttctggaataaacagtgggacaaacatggcacctgtgggtatcccacaataaaagacaaga
accattactttcaaacagtaatcaaaatgtacataacccagaaacaaaacgtttctcaaatcctatccaaagccaacatc
aatccagacggtataggcaggacacggaagctaatcgaaagtgccatacgcaatggtaccaacgataaggaaccaaaact
caagtgccaaaagaataatgggactattgaattagttgaggtcagtctttgcagcaattacctcggaaaacatttcataa
attgccccaacaaaattccagaaggctcacgatatttctgccccatcaaagatatccggtattaa
back to top
>EU310474.1-S34-RNase457
gtgtacggttcacggtttgtggccttctaacttgaatggaaatgactcacaatatggtaaggacccgccatatcatccgg
taatcttattagcataataagatagtccccaatatttatcccatttatgtactggaacaagggagtagttttacgcagca
atatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacggttcacggtttgt
ggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaaggtaatcttatcaata
atctaatactcaacatatatgttcatacaagtgcaaatattacaattaatttcaatttaatcataaatgttttctattta
tatatttttatttatatggcagtaggatatccgaaacccctgatattgctgcgtaaa
back to top
>AB540122.1-S34-RNase.m1699
atggggattacgaggatgatatatgtggttacgatggtattttcattaattgcattaatattgtcttcgtccncgatggg
atacgattattttcaatttacgcagcaatatcagccggcagtctgcaactctaatcctactccttgtaaggatcctactg
agaaattgtttacggttcacggtttgtggccttcaaactctaatggacctgacccggtaaactgcaagccaaaaaccaag
gtgcctcaggcgcagcagccgatagatgcatcactcaaaccccagttggaaattatttggccgaacgtactcaatcgagc
cgataatgaaagcttctggaataaacagtgggacaaacatggcacctgtgggtatcccacaataaaagacaagaaccatt
actttcaaacagtaatcaaaatgtacataacccagaaacaaaacgtttctcaaatcctatccaaagccaacatcaatcca
gacggtataggcaggacacggaagctaatcgaaagtgccatacgcaatggtaccaacgataaggaaccaaaactcaagtg
ccaaaagaataatgggactattgaattagttgaggtcagtctttgcagcaattacctcggaaaacatttcataaattgcc
ccaacaaaattccagaaggctcacgatatttctgccccatcaaagatatccggtattaa
back to top