S34-RNase, S34-RNase (gene) Pyrus pyrifolia

Gene Overview
Name S34-RNase
Gene Symbol S34-RNase
Type gene
Organism Pyrus pyrifolia
Synonym S34-RNase
Description NA
Comment self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S34-RNaseDQ224345.1-S34-RNasePyrus pyrifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S34-RNaseDQ269500.1-S34-RNase.m1Pyrus pyrifoliamRNA
S34-RNaseDQ224345.1-S34-RNase.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ224345.1-S34-RNase N/A DQ224345.1
mRNA parsed from NCBI nr database DQ269500.1-S34-RNase.m1 N/A DQ269500.1
mRNA parsed from NCBI nr database DQ224345.1-S34-RNase.m1 N/A DQ224345.1

Sequence(s):
>DQ224345.1-S34-RNase428
tttacgcagcaatatcagccggctgtctgcaactctaaccctactccttgtaaggattctccagacaagttgtttacggt
tcacggcttgtggccttcaaactcgagtggacctcacccacataattgcacgaatacaaccgtgaaatctcagacggtaa
tattattgataatcagatattgttagattagtcattgacggggtttgaacccacgtcatcatgcaaagtttcaacatctt
tccgcgactgtagtaaagagctacttgcttatttcatatatacatatactcaacatagattttcatgcaagagtgtgcaa
atattacaattaatttaaaatttaatcataattatttttctcttatttatattatattgtcagataagatcactcaaagc
ccagttggaaattatttggccgaacgta
back to top
>DQ269500.1-S34-RNase.m1297
atggggatgacggggatgatatatatggttacgatggtattttcattaactgtattagtattgtgttcctctacggtggg
atacgattattttcaatttacccagcaatatcagccggctgtctgcaactctagtactactccttgtaaggatcctgctg
acaagctgtttacggttcacggtttgtggccctcaaactggaatggatcccacccagtaaattgcacgaataaaaccatg
aattccctgacgatgggaaatctgacagcccagttggaaattatttggccgaatgta
back to top
>DQ224345.1-S34-RNase.m1201
tttacgcagcaatatcagccggctgtctgcaactctaaccctactccttgtaaggattctccagacaagttgtttacggt
tcacggcttgtggccttcaaactcgagtggacctcacccacataattgcacgaatacaaccgtgaaatctcagacgataa
gatcactcaaagcccagttggaaattatttggccgaacgta
back to top