S35-RNase, S35-RNase (gene) Pyrus ussuriensis

Gene Overview
Name S35-RNase
Gene Symbol S35-RNase
Type gene
Organism Pyrus ussuriensis
Synonym S35-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S35-RNaseKC529676.1-S35-RNasePyrus ussuriensisgene
S35-RNaseKC529675.1-S35-RNasePyrus ussuriensisgene
S35-RNaseKC529674.1-S35-RNasePyrus ussuriensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S35-RNaseDQ839240.1-S35-RNase.m1Pyrus ussuriensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus ussuriensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC529676.1-S35-RNase N/A KC529676.1
gene parsed from NCBI nr database KC529675.1-S35-RNase N/A KC529675.1
gene parsed from NCBI nr database KC529674.1-S35-RNase N/A KC529674.1
mRNA parsed from NCBI nr database DQ839240.1-S35-RNase.m1 N/A DQ839240.1

Sequence(s):
>KC529676.1-S35-RNase585
tttttacgcagcaatatcagccagccggccgtatgcaactctaatcctactccttgtaacgatcctcctgacaagttgtt
tacggttcatggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaagaatatacaaatgaactctcgga
aggtaatattattaataatgagatggtcaatattgtttatttcgtttatgcatctgtgtataaaatatattacatatact
caacatagattttcatgcacgcctgtgcaaatattacaattaatttaaaatttaatcatgtattgtttctattatataat
tatattgccagataggaaatatgacagcccagttggaaattatttggccgaacgtgctcaatcgaaccgatcatgtaggc
ttctgggaaagagagtggctcaaacatggcacctgcgggtatcccacaataagggacgacatgcattacttgaaaacagt
aatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctcaagggcgatgattcaaccgaacgggaaaaaca
ggtcactggtggatattgaaaatgc
back to top
>KC529675.1-S35-RNase587
tttttacgcagcaatatcagccagccggccgtatgcaactctaatcctactccttgtaacgatcctcctgacaagttgtt
tacggttcatggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaagaatatacaaatgaactctcgga
aggtaatattattaataatgagatggtcaatattgtttatttcgtttatgcatctgtgtataaaatatattacatatact
caacatagattttcatgcacgcctgtgcaaatattacaattaatttaaaatttaatcatgtattgtttctattatataat
tatattgccagataggaaatatgacagcccagttggaaattatttggccgaacgtgctcaatcgaaccgatcatgtaggc
ttctgggaaagagagtggctcaaacatggcacctgcgggtatcccacaataagggacgacatgcattacttgaaaacagt
aatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctcaagggcgatgattcaaccgaacgggaaaaaca
ggtcactggtggatattgaaaatgcaa
back to top
>KC529674.1-S35-RNase585
tttttacgcagcaatatcagccagccggccgtatgcaactctaatcctactccttgtaacgatcctcctgacaagttgtt
tacggttcatggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaagaatatacaaatgaactctcgga
aggtaatattattaataatgagatggtcaatattgtttatttcgtttatgcatctgtgtataaaatatattacatatact
caacatagattttcatgcacgcctgtgcaaatattacaattaatttaaaatttaatcatgtattgtttctattatataat
tatattgccagataggaaatatgacagcccagttggaaattatttggccgaacgtgctcaatcgaaccgatcatgtaggc
ttctgggaaagagagtggctcaaacatggcacctgtgggtatcccacaataagggacgacatgcattacttgaaaacagt
aatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctcaagggcgatgattcaaccgaacgggaaaaaca
ggtcactggtggatattgaaaatgc
back to top
>DQ839240.1-S35-RNase.m1684
atgggaaatacggggatgatatatatgtttacaatggtattttcattaatagtattaatattgtcttcgtcaacggtggg
atacgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcgtcctg
aaaaattgtttacggttcacggtttgtggccttcaaacaagaagggacctgacccagaaaaatgcaagaatatacaaatg
aattctcagaagataggaaatatggcagcccagttggaaattatttggccgaatgtgctcaatcgaaccgatcatgtagg
cttctgggaaagagagtggctcaaacatggcacctgcgggtatcccacaataagggacgacatgcattacttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgcaattctctcgaaggcgatgattcaaccgaacgggcaaaac
aggtcattggtggatattgaaaatgccatacgcagtggtaccaacaatacgaaaccaaaattcaagtgccaaaagaatac
taggacgacgactgaattagttgaggtcactctttgcagtgatagagacttaacgaagttcataaattgcccccaaccac
aacaaggatcacgatatctctgccccgccgatgttcagtattaa
back to top