S35-RNase, S35-RNase (gene) Pyrus x bretschneideri

Gene Overview
Name S35-RNase
Gene Symbol S35-RNase
Type gene
Organism Pyrus x bretschneideri
Synonym S35-RNase
Description NA
Comment self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus x bretschneiderigene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S35-RNaseDQ224344.1-S35-RNase.m1Pyrus x bretschneiderimRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ224344.1-S35-RNase.m1 N/A DQ224344.1

Sequence(s):
>DQ224344.1-S35-RNase.m1684
atgggaattacggggatgatatatatgtttacaatggtattttcattaatagtattaatattgtcttcgtccacggtggg
atacgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcgtcctg
aaaaattgtttacggttcacggtttgtggccttcaaacaagaagggacctgacccagaaaaatgcaagaatatacaaatg
aattctcagaagataggaaatatggcagcccagttggaaattatttggccgaacgtgctcaatcgaaccgatcatgtagg
cttctgggaaagagagtggctcaaacatggcacctgcgggtatcccacaataagggacgacatgcattacttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgcaattctctcgaaggcgatgattcaaccgaacgggcaaaac
aggtcattggtggatattgaaaatgccatacgcagtggtaccaacaatacgaaaccaaaattcaagtgccaaaagaatac
taggacgacgactgaattagttgaggtcactctttgcagtgatagagacttaacgaagttcataaattgcccccaaccac
aacaaggatcacgatatctctgccccgccgatgttcagtattaa
back to top