S36-RNase, S36-RNase (gene) Malus x domestica

Gene Overview
Name S36-RNase
Gene Symbol S36-RNase
Type gene
Organism Malus x domestica
Synonym S36-RNase
Description NA
Comment self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S36-RNaseEU391606.1-S36-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU391606.1-S36-RNase.m1 N/A EU391606.1

Sequence(s):
>EU391606.1-S36-RNase.m1177
tttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctcctgaaaaattgtttacggt
tcacggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaagaatatacaaatgaattctcagaaggata
gaaatatgaatgtctgg
back to top