S36-RNase, S36-RNase (gene) Prunus mume

Gene Overview
Name S36-RNase
Gene Symbol S36-RNase
Type gene
Organism Prunus mume
Synonym putative self-incompatibility S-RNase
Description NA
Comment S36-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S36-RNaseJX065224.1-S36-RNasePrunus mumegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S36-RNaseJX065224.1-S36-RNase.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus mumegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JX065224.1-S36-RNase N/A JX065224.1
mRNA parsed from NCBI nr database JX065224.1-S36-RNase.m1 N/A JX065224.1

Sequence(s):
>JX065224.1-S36-RNase485
ctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatggggcgcattttgagaacaggaaagtggtatg
tgtttcattatatttttcacttacaatttagcatttagttcttcggaaattagattgtcatatttgaacataatatactg
ttttaagttagattgtgataaaattttgatgctggtcctcatctaatcataaaccttaattagttcataagttgttcatt
aataagaatatatctaatcatctaattaaagcgcctatgtatatattcaaaatatattagataataaaagggccaaaaca
aaaattcaatttaatgggaaatgtttattgtttataaaaatcaaaatatgtctatattgcttggatgtctcagtaccctc
aattgcgatccaaactgaagaggtcttggcccgacgtggaaagtggcaacgatacaaacttctgggaaagcgaatggaac
aaaca
back to top
>JX065224.1-S36-RNase.m1167
ctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatggggcgcattttgagaacaggaaagtgtaccc
tcaattgcgatccaaactgaagaggtcttggcccgacgtggaaagtggcaacgatacaaacttctgggaaagcgaatgga
acaaaca
back to top