S36A-RNAse, S36A-RNAse (gene) Prunus cerasus

Gene Overview
Name S36A-RNAse
Gene Symbol S36A-RNAse
Type gene
Organism Prunus cerasus
Synonym S36a-RNase
Description NA
Comment ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S36A-RNAseEU042127.1-S36A-RNAsePrunus cerasusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S36A-RNAseEU042127.1-S36A-RNAse.m1Prunus cerasusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus cerasusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU042127.1-S36A-RNAse N/A EU042127.1
mRNA parsed from NCBI nr database EU042127.1-S36A-RNAse.m1 N/A EU042127.1

Sequence(s):
>EU042127.1-S36A-RNAse1547
atggtgacgttgaaatcgtcactcgctttccttgttcttgcttttgctttgttcttgtgtttcattatgagcactggtga
tggtaggctgcattacaatcttttgctctttatatcccatatatatgcatataattaggcattgcgtttttgtacttcct
attttatgtttagggaatattgtgagtgtccgatgaaatatcaggtaacgaaggacttgatctaacgcactagtctttgg
gaattatttttctgcaataagtgcagtattcatcattggaagccaaaattatgttctttatacataaaaaaatccttatt
ttagataccatttccttcttacaatatataattttcgcaggatcttatgactattttcaatttgtgcaacaatggccacc
ggctacctgcagtcttagcaggacaccttgctacaaaccccggccacctcaaatcttcaccatccatggcctatggccaa
gtaactattcaaacccaaagaggcccagtaattgcagggggtcgctatttgattcaaggaaagtggtatgtattgatttt
tttctcacttactctttagcatttagtttaaaaaaaagttagattgtcatatgaagacagtacactctttcgataaaacc
ttgggtgttagataaatcctgatgttgctttatcccaacatagggggaggaggggtggttgtatgttaggaaattctctc
cactcttttttctttgatacaaggggagggggaggtgagcctaggacatcgggtgcatagataaatgcctttaactactt
atttgaaagtcctttcctttttaatttaagtttttcacttttataattttatttcataagataaaaattaagtaattagt
ccagctgtaaaaaataaattttttttttttaaggtggacacatgaccatatttaagtgggagtaccattattgttacata
ttttattattgtaaatcaaaatcactaattcagtatagtactcaggtttaacgtaaaaattatcttattcaagaacggaa
atctctctcttaagtttttactattccttaaaatatgtatgaattgcttggatgtctcagtaccctcagttgcgattgaa
tctgaagatatcttggcccaacgtgaaaagtggcaatgatacagaattttgggaaagcgaatggaacaaacatggtagat
gttccgaacagacactcaaccaaatgcaatacttcgagcgatcagacgaaatgtggaactcttacaatattacggagatc
cttaaaaaagctcaaatcgtaccaaatgcgacacggacatggaagtactcggacatattatcacccattaaagcagcaac
taacacaacacccatccttcgttgcaaacctgatccagcacagtctaagagccaaccatcgcagcctaagagcccccaaa
agcctcagttgttacatgaagtggtattttgttatgattatcatgcaaaaaagcagattgactgtaaccgaacaggatgc
cttaataaagacatctcgtttcaataa
back to top
>EU042127.1-S36A-RNAse.m1714
atggtgacgttgaaatcgtcactcgctttccttgttcttgcttttgctttgttcttgtgtttcattatgagcactggtga
tggatcttatgactattttcaatttgtgcaacaatggccaccggctacctgcagtcttagcaggacaccttgctacaaac
cccggccacctcaaatcttcaccatccatggcctatggccaagtaactattcaaacccaaagaggcccagtaattgcagg
gggtcgctatttgattcaaggaaagtgtaccctcagttgcgattgaatctgaagatatcttggcccaacgtgaaaagtgg
caatgatacagaattttgggaaagcgaatggaacaaacatggtagatgttccgaacagacactcaaccaaatgcaatact
tcgagcgatcagacgaaatgtggaactcttacaatattacggagatccttaaaaaagctcaaatcgtaccaaatgcgaca
cggacatggaagtactcggacatattatcacccattaaagcagcaactaacacaacacccatccttcgttgcaaacctga
tccagcacagtctaagagccaaccatcgcagcctaagagcccccaaaagcctcagttgttacatgaagtggtattttgtt
atgattatcatgcaaaaaagcagattgactgtaaccgaacaggatgccttaataaagacatctcgtttcaataa
back to top