S37-RNase, S37-RNase (gene) Prunus avium

Gene Overview
Name S37-RNase
Gene Symbol S37-RNase
Type gene
Organism Prunus avium
Synonym S37-ribonuclease
Description NA
Comment S37-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S37-RNaseJQ280522.1-S37-RNasePrunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S37-RNaseJQ280522.1-S37-RNase.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JQ280522.1-S37-RNase N/A JQ280522.1
mRNA parsed from NCBI nr database JQ280522.1-S37-RNase.m1 N/A JQ280522.1

Sequence(s):
>JQ280522.1-S37-RNase522
cacggaggcccagtaattgcaatgggtcgcaatttaagtacgggaaagtggtatgtattgtttcaaatattttttttctt
tcactttgctcttagaaaattagattgtcatatgaagataatatattttattcaataagccatgggtcttggataaaatt
ttgatgtttgtctccaattatgtatattttgcttggatgtctcagtaccctcagttgcgatccaaactgaagaaatcttg
gccggacgtggaaagtgggaatgatacaaaattttgggaaggcgaatggaacaaacatggtacatgttctgaagagaaac
taaaccaaatgcaatacttcgagagatcccacaacatgtggaggtcgtacaatattacagagatccttaaaaacgcttca
atcgtaccacatccgacacaaacatggagctactcggacatagtatcacccattaaaacagcaactggaagaacacccac
ccttcgttgcagaactgatccagcacacccaaatattgactt
back to top
>JQ280522.1-S37-RNase.m1367
cacggaggcccagtaattgcaatgggtcgcaatttaagtacgggaaagtgtaccctcagttgcgatccaaactgaagaaa
tcttggccggacgtggaaagtgggaatgatacaaaattttgggaaggcgaatggaacaaacatggtacatgttctgaaga
gaaactaaaccaaatgcaatacttcgagagatcccacaacatgtggaggtcgtacaatattacagagatccttaaaaacg
cttcaatcgtaccacatccgacacaaacatggagctactcggacatagtatcacccattaaaacagcaactggaagaaca
cccacccttcgttgcagaactgatccagcacacccaaatattgactt
back to top