S38-RNase, S38-RNase (gene) Prunus avium

Gene Overview
Name S38-RNase
Gene Symbol S38-RNase
Type gene
Organism Prunus avium
Synonym S38-ribonuclease
Description NA
Comment S38-RNase; coding region disrupted by sequencing gap
S38-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S38-RNaseJQ280518.1-S38-RNasePrunus aviumgene
S38-RNaseJQ280517.1-S38-RNasePrunus aviumgene
S38-RNaseJQ280516.1-S38-RNasePrunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S38-RNaseJQ280518.1-S38-RNase.m1Prunus aviummRNA
S38-RNaseJQ280518.1-S38-RNase.m2Prunus aviummRNA
S38-RNaseJQ280517.1-S38-RNase.m1Prunus aviummRNA
S38-RNaseJQ280516.1-S38-RNase.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JQ280518.1-S38-RNase N/A JQ280518.1
gene parsed from NCBI nr database JQ280517.1-S38-RNase N/A JQ280517.1
gene parsed from NCBI nr database JQ280516.1-S38-RNase N/A JQ280516.1
mRNA parsed from NCBI nr database JQ280518.1-S38-RNase.m1 N/A JQ280518.1
mRNA parsed from NCBI nr database JQ280518.1-S38-RNase.m2 N/A JQ280518.1
mRNA parsed from NCBI nr database JQ280517.1-S38-RNase.m1 N/A JQ280517.1
mRNA parsed from NCBI nr database JQ280516.1-S38-RNase.m1 N/A JQ280516.1

Sequence(s):
>JQ280518.1-S38-RNase710
acttgttcttggttttgctttcttcttttgttacgttatgagcagtggtgggttgcattacattcttttgctctttaaat
cttatatgcatataatcaacattgtgtttttctacttgtattttttggggattgtattctgcatgtcctcttttgcttat
tctgataattgttacaataactgcagcctactggaaacctaaagttaattatgttctttattcttcaaatccttatttat
gatagcattaatattctcacaataattttggcaggatcttatgactattttcaatttgtgcaacaatggccaccaaccaa
ctgcaaatttcgtaaatgctccaaaccccggcctttacaaagattcaccatccatggcctatggnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnngttctgtagagaaactaaaccaaatgcaatacttcgagcgatcctacgcaatgtggagatcgtacaatattacaaa
gatccttcaaaacgcttcaattgtaccaagtacgacacgaacatggacctactccgacatagtatctcccattaaagcag
caacaggaagaacacctctccttcgctgcaaacaggataagaagactcagctgttacatgaagtggtatt
back to top
>JQ280517.1-S38-RNase384
acttgttcttggtttcgctttcttcctttgttacgttatgagcagtggtgggttgcattacattcttttgctctttaaat
cttatatgcatataatcaacattgtgtttttctacttgtattttttggggattgtattctgcatgtcctcttttgtttat
tctgataattgttacaataactgcagcctactggaaacctaaagttaattatgttctttattcttcaaatccttatttat
gatagcattaatattctcacaataattttggcaggatcttatgactattttcaatttgtgcaacaatggccaccaaccaa
ctgcaaatttcgtaaatgctccaaaccccggcctttacaaagattcaccatccatggcctatgg
back to top
>JQ280516.1-S38-RNase384
acttgttcttggtttcgctttcttcttttgttacgttatgagcagtggtgggttgcattacattcttttgctctttaaat
cttatatgcatataatcaacattgtgtttttctacttgtattttttggggattgtatcctgcatgtcctcttttgtttat
tctgataattgttacaataactgcagcctactggaaacctaaagttaattatgttctttattcttcaaatccttatttat
gatagcattaatattctcacaataattttggcaggatcttatgactattttcaatttgtgcaacaatggccaccaaccaa
ctgcaaatttcgtaaatgctccaaaccccggcctttacaaagattcaccatccatggcctatgg
back to top
>JQ280518.1-S38-RNase.m1157
acttgttcttggttttgctttcttcttttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaat
ggccaccaaccaactgcaaatttcgtaaatgctccaaaccccggcctttacaaagattcaccatccatggcctatgg
back to top
>JQ280518.1-S38-RNase.m2226
gttctgtagagaaactaaaccaaatgcaatacttcgagcgatcctacgcaatgtggagatcgtacaatattacaaagatc
cttcaaaacgcttcaattgtaccaagtacgacacgaacatggacctactccgacatagtatctcccattaaagcagcaac
aggaagaacacctctccttcgctgcaaacaggataagaagactcagctgttacatgaagtggtatt
back to top
>JQ280517.1-S38-RNase.m1157
acttgttcttggtttcgctttcttcctttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaat
ggccaccaaccaactgcaaatttcgtaaatgctccaaaccccggcctttacaaagattcaccatccatggcctatgg
back to top
>JQ280516.1-S38-RNase.m1157
acttgttcttggtttcgctttcttcttttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaat
ggccaccaaccaactgcaaatttcgtaaatgctccaaaccccggcctttacaaagattcaccatccatggcctatgg
back to top