S39-RNase, S39-RNase (gene) Malus x domestica

Gene Overview
Name S39-RNase
Gene Symbol S39-RNase
Type gene
Organism Malus x domestica
Synonym S39-RNase
Description NA
Comment self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S39-RNaseEU391610.1-S39-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU391610.1-S39-RNase.m1 N/A EU391610.1

Sequence(s):
>EU391610.1-S39-RNase.m1177
tttacgcagcaatatcagccggctgcctgcaactctaatcctactccttgtaaagatcctcctgacaagttgtttacggt
tcacggtttgtggccttcaaacatgaatcgaagtgaattatttaattgcagtagttcaaacgtgacttatgcgaagatac
aaaatccgaatgtttga
back to top