S4-RNase, S4-RNase (gene) Malus x domestica

Gene Overview
Name S4-RNase
Gene Symbol S4-RNase
Type gene
Organism Malus x domestica
Synonym S4-RNase protein
S4-RNase
Description NA
Comment self-incompatibility ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseHQ689390.1-S4-RNaseMalus x domesticagene
S4-RNaseAB428426.1-S4-RNaseMalus x domesticagene
S4-RNaseEU427456.1-S4-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseHQ689390.1-S4-RNase.m1Malus x domesticamRNA
S4-RNaseAB428426.1-S4-RNase.m1Malus x domesticamRNA
S4-RNaseEU427456.1-S4-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HQ689390.1-S4-RNase N/A HQ689390.1
gene parsed from NCBI nr database AB428426.1-S4-RNase N/A AB428426.1
gene parsed from NCBI nr database EU427456.1-S4-RNase N/A EU427456.1
mRNA parsed from NCBI nr database HQ689390.1-S4-RNase.m1 N/A HQ689390.1
mRNA parsed from NCBI nr database AB428426.1-S4-RNase.m1 N/A AB428426.1
mRNA parsed from NCBI nr database EU427456.1-S4-RNase.m1 N/A EU427456.1

Sequence(s):
>HQ689390.1-S4-RNase339
ttttacgcagcaatatcagccggctgcctgtaactctaatcccactccttgtaaggatcctactgacaagttgtttacgg
ttcatggtttgtggccttcaaacaaaataggacgtgacccagaatattgcaagacaaggaatcgtcggaaggtaatatta
ttagtgatcagatagtcaatattgtttatttcatttatataattgtgtgtgtgtgtatacataatttttcttatacaatt
aatttaaaatttaatcataaattttttatgttgtacatattatgttgtcagagagcaaaaacactcgaaccccagttgga
aatgatttggccgaacgta
back to top
>AB428426.1-S4-RNase637
caatttacgcagcaatatcagccggctgcctgtaactctaatcccactccttgtaaggatcctactgacaagttgtttac
ggttcatggtttgtggccttcaaacaaaataggacgtgacccagaatattgcaagacaaggaatcgtcggaaggtaatat
tattagtgatcagatagtcaatattgtttatttcatttatataattgtgtgtgtgtgtatacataatttttcttatacaa
ttaatttaaaatttaatcataaattttttatgttgtacatattatgttgtcagagagcaaaaacactcgaaccccagttg
gaaattatttggccgaacgtcctcgatcgaaccaatcatacaggcttctggcgtagacagtggaaaaaacatggcacctg
tgggtatcccacaatacagaacgagaatgattactttgaaacagtaatcaaaatgtacataaccgagaaacaaaacgtct
ctcgaatcctctcaaatgcaaagattgaaccagacgggcaaagcagaccgctggtggacattgaaaatgccatacgcaac
ggtacccacaataagaaaccgaaattcaagtgccaaaagaataatggggtgactgaattggttgagatcactctttg
back to top
>EU427456.1-S4-RNase337
tttacgcagcaatatcagccggctgcctgtaactctaatcccactccttgtaaggatcctactgacaagttgtttacggt
tcatggtttgtggccttcaaacaaaataggacgtgacccagaatattgcaagacaaggaatcgtcggaaggtaatattat
tagtgatcagatagtcaatattgtttatttcatttatataattgtgtgtgtgtgtatacataatttttcttatacaatta
atttaaaatttaatcataaattttttatgttgtacatattatgttgtcagagagcaaaaacactcgaaccccagttggaa
attatttggccgaacgt
back to top
>HQ689390.1-S4-RNase.m1199
ttttacgcagcaatatcagccggctgcctgtaactctaatcccactccttgtaaggatcctactgacaagttgtttacgg
ttcatggtttgtggccttcaaacaaaataggacgtgacccagaatattgcaagacaaggaatcgtcggaagagagcaaaa
acactcgaaccccagttggaaatgatttggccgaacgta
back to top
>AB428426.1-S4-RNase.m1473
caatttacgcagcaatatcagccggctgcctgtaactctaatcccactccttgtaaggatcctactgacaagttgtttac
ggttcatggtttgtggccttcaaacaaaataggacgtgacccagaatattgcaagacaaggaatcgtcggaagttggaaa
ttatttggccgaacgtcctcgatcgaaccaatcatacaggcttctggcgtagacagtggaaaaaacatggcacctgtggg
tatcccacaatacagaacgagaatgattactttgaaacagtaatcaaaatgtacataaccgagaaacaaaacgtctctcg
aatcctctcaaatgcaaagattgaaccagacgggcaaagcagaccgctggtggacattgaaaatgccatacgcaacggta
cccacaataagaaaccgaaattcaagtgccaaaagaataatggggtgactgaattggttgagatcactctttg
back to top
>EU427456.1-S4-RNase.m1197
tttacgcagcaatatcagccggctgcctgtaactctaatcccactccttgtaaggatcctactgacaagttgtttacggt
tcatggtttgtggccttcaaacaaaataggacgtgacccagaatattgcaagacaaggaatcgtcggaagagagcaaaaa
cactcgaaccccagttggaaattatttggccgaacgt
back to top