S4-RNase, S4-RNase (gene) Prunus cerasifera

Gene Overview
Name S4-RNase
Gene Symbol S4-RNase
Type gene
Organism Prunus cerasifera
Synonym S4-RNase
Description NA
Comment S4-RNase self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseEF661874.1-S4-RNasePrunus cerasiferagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseEF661874.1-S4-RNase.m1Prunus cerasiferamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus cerasiferagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EF661874.1-S4-RNase N/A EF661874.1
mRNA parsed from NCBI nr database EF661874.1-S4-RNase.m1 N/A EF661874.1

Sequence(s):
>EF661874.1-S4-RNase464
ctatggccaagtaattattcaaacccaacgaagcccagtaattgcgctgggtcgcaatttaactttactaaagtggtatg
cattgtttcagttttttttaattttttaatttttaagagttactcattagcatttagttttcagaaaattataggtttaa
tgatgaaaaaaattattatccaataatgaaattctaattatgccttaaatttgtactttttttctcaaaatatgtatatt
gcttggatgtctcagtcccctcaattgcgatctatactgaagacatcttggccagacgtggaaagtggcaatgatacaaa
gttttgggaaggcgaatggaacaaacatggtagatgttccgagcagacacttaaccaaatgcaatactttcagcgatcct
tcgcaatgtggagatcgtacaatattacaaatatccttaaaaacgcttcaatcgtaccacatcc
back to top
>EF661874.1-S4-RNase.m1281
ctatggccaagtaattattcaaacccaacgaagcccagtaattgcgctgggtcgcaatttaactttactaaatcccctca
attgcgatctatactgaagacatcttggccagacgtggaaagtggcaatgatacaaagttttgggaaggcgaatggaaca
aacatggtagatgttccgagcagacacttaaccaaatgcaatactttcagcgatccttcgcaatgtggagatcgtacaat
attacaaatatccttaaaaacgcttcaatcgtaccacatcc
back to top