S4-RNase, S4-RNase (gene) Pyrus communis

Gene Overview
Name S4-RNase
Gene Symbol S4-RNase
Type gene
Organism Pyrus communis
Synonym S4-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseKC529682.1-S4-RNasePyrus communisgene
S4-RNaseKC529679.1-S4-RNasePyrus communisgene
S4-RNaseKC529678.1-S4-RNasePyrus communisgene
S4-RNaseKC529677.1-S4-RNasePyrus communisgene
S4-RNaseKC529668.1-S4-RNasePyrus communisgene
S4-RNaseKC529667.1-S4-RNasePyrus communisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseKC588834.1-S4-RNase.m1Pyrus communismRNA
S4-RNaseKC529682.1-S4-RNase.m1Pyrus communismRNA
S4-RNaseKC529679.1-S4-RNase.m1Pyrus communismRNA
S4-RNaseKC529678.1-S4-RNase.m1Pyrus communismRNA
S4-RNaseKC529677.1-S4-RNase.m1Pyrus communismRNA
S4-RNaseKC529668.1-S4-RNase.m1Pyrus communismRNA
S4-RNaseKC529667.1-S4-RNase.m1Pyrus communismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus communisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC529682.1-S4-RNase N/A KC529682.1
gene parsed from NCBI nr database KC529679.1-S4-RNase N/A KC529679.1
gene parsed from NCBI nr database KC529678.1-S4-RNase N/A KC529678.1
gene parsed from NCBI nr database KC529677.1-S4-RNase N/A KC529677.1
gene parsed from NCBI nr database KC529668.1-S4-RNase N/A KC529668.1
gene parsed from NCBI nr database KC529667.1-S4-RNase N/A KC529667.1
mRNA parsed from NCBI nr database KC588834.1-S4-RNase.m1 N/A KC588834.1
mRNA parsed from NCBI nr database KC529682.1-S4-RNase.m1 N/A KC529682.1
mRNA parsed from NCBI nr database KC529679.1-S4-RNase.m1 N/A KC529679.1
mRNA parsed from NCBI nr database KC529678.1-S4-RNase.m1 N/A KC529678.1
mRNA parsed from NCBI nr database KC529677.1-S4-RNase.m1 N/A KC529677.1
mRNA parsed from NCBI nr database KC529668.1-S4-RNase.m1 N/A KC529668.1
mRNA parsed from NCBI nr database KC529667.1-S4-RNase.m1 N/A KC529667.1

Sequence(s):
>KC529682.1-S4-RNase654
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatatt
attagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgcta
gagcctccaaatttttaaaccaaatgatgtgtcacaataagatataagaaatttagtctttctaacattactctatattt
ttttgatatatacaaatattacacttaatttaaaattttatcataaattatttctattatatattattatattgtcagat
gaaaatactcgaaccccacttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaac
agtgggataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtac
acaacccagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtgga
tattgaaaatgcca
back to top
>KC529679.1-S4-RNase654
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatatt
attagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgcta
gagcctccaaatttttaaaccaaatgatgtgtcacaataagatataagaaatttagtctttctaacattactctatattt
ttttgatatatacaaatattacacttaatttaaaattttatcataaattatttctattatatattattatattgtcagat
gaaaatactcgaaccccacttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaac
agtgggataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtac
acaacccagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtgga
tattgaaaatgcca
back to top
>KC529678.1-S4-RNase654
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatatt
attagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgcta
aagcctccaaatttttaaaccaaatgatgtgtcacaataagatataagaaatttagtctttctaacattactctatattt
ttttgatatatacaaatattacacttaatttaaaattttatcataaattatttctattatatattattatattgccagat
gaaaatactcgaaccccacttggtaattatttggccgaacgtcctcaatcgaaacgatcatgaagtcttctggcgtaaac
agtgggataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtac
acaacccagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtgga
tattgaaaatgcca
back to top
>KC529677.1-S4-RNase654
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatatt
attagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgcta
gagcctccaaatttttaaaccaaatgatgtgtcacaataagatataagaaatttagtctttctaacattactctatattt
ttttgatatatacaaatattacacttaatttaaaattttatcataaattatttctattatatattattatattgtcagat
gaaaatactcgaaccccacttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaac
agtgggataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtac
acaacccagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtgga
tattgaaaatgcca
back to top
>KC529668.1-S4-RNase654
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatatt
attagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgcta
gagcctccaaatttttaaaccaaatgatgtgtcacaataagatataagaaatttagtctttctaacattactctatattt
ttttgatatatacaaatattacacttaatttaaaattttatcataaattatttctattatatattattatattgtcagat
gaaaatactcgaaccccacttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaac
agtgggataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtac
acaacccagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtgga
tattgaaaatgcca
back to top
>KC529667.1-S4-RNase650
tttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttactgt
tcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacggtaatattat
tagcataatcagatagtcaatattgtttatctcatttatgtacttgtgtgtgtatatatatatttttggataatgctaaa
gcctccaaatttttaaaccaaatgatgtgtcacaataagatataagaaatttagtctttctaacattactctatattttt
ttgatatatacaaatattacacttaatttaaaattttatcataaattatttctattatatattattatattgccagatga
aaatactcgaaccccacttggtaattatttggccgaacgtcctcaatcgaaacgatcatgaagtcttctggcgtaaacag
tgggataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtacac
aacccagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtggata
ttgaaaatgc
back to top
>KC588834.1-S4-RNase.m1410
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgatgaaaat
actcgaaccccacttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaacagtggg
ataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtacacaacc
cagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtggatattga
aaatgcaaaa
back to top
>KC529682.1-S4-RNase.m1408
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgatgaaaat
actcgaaccccacttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaacagtggg
ataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtacacaacc
cagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtggatattga
aaatgcca
back to top
>KC529679.1-S4-RNase.m1408
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgatgaaaat
actcgaaccccacttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaacagtggg
ataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtacacaacc
cagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtggatattga
aaatgcca
back to top
>KC529678.1-S4-RNase.m1408
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgatgaaaat
actcgaaccccacttggtaattatttggccgaacgtcctcaatcgaaacgatcatgaagtcttctggcgtaaacagtggg
ataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtacacaacc
cagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtggatattga
aaatgcca
back to top
>KC529677.1-S4-RNase.m1408
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgatgaaaat
actcgaaccccacttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaacagtggg
ataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtacacaacc
cagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtggatattga
aaatgcca
back to top
>KC529668.1-S4-RNase.m1408
tttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttact
gttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgatgaaaat
actcgaaccccacttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaacagtggg
ataaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtacacaacc
cagaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtggatattga
aaatgcca
back to top
>KC529667.1-S4-RNase.m1404
tttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttactgt
tcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgatgaaaatac
tcgaaccccacttggtaattatttggccgaacgtcctcaatcgaaacgatcatgaagtcttctggcgtaaacagtgggat
aaacatggctcctgtgcgtcttccccgattcagaaccagacgcattactttgatacagtaatcaaaatgtacacaaccca
gaaacaaaacgtttctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggaggctggtggatattgaaa
atgc
back to top