S4-RNase, S4-RNase (gene) Pyrus pyrifolia

Gene Overview
Name S4-RNase
Gene Symbol S4-RNase
Type gene
Organism Pyrus pyrifolia
Synonym S ribonuclease
S4-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseAB545981.1-S4-RNasePyrus pyrifoliagene
S4-RNaseAB308360.1-S4-RNasePyrus pyrifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseAB545981.1-S4-RNase.m5Pyrus pyrifoliamRNA
S4-RNaseAB308360.1-S4-RNase.m1Pyrus pyrifoliamRNA
S4-RNaseAB014072.1-S4-RNase.m1Pyrus pyrifoliamRNA
S4-RNaseAB009385.1-S4-RNase.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB545981.1-S4-RNase N/A AB545981.1
gene parsed from NCBI nr database AB308360.1-S4-RNase N/A AB308360.1
mRNA parsed from NCBI nr database AB545981.1-S4-RNase.m5 N/A AB545981.1
mRNA parsed from NCBI nr database AB308360.1-S4-RNase.m1 N/A AB308360.1
mRNA parsed from NCBI nr database AB014072.1-S4-RNase.m1 N/A AB014072.1
mRNA parsed from NCBI nr database AB009385.1-S4-RNase.m1 N/A AB009385.1

Sequence(s):
>AB545981.1-S4-RNase855
atgggaattacggggatgacatatatgtttacaatggtattgtcattaattgtattaatattctctgcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacaggaatggacctgacccagaaaaatgcaagactacaaccatg
aattctcagaaggtaatattattaataatgagatagtcaatattgtttatttcatttatgcacgtgtgtatatatacatt
acatatgctcagcatagattttcatgcacgcctgtgcaaatattacaattaatttaaaatttaatcatgaattgtttcta
ttatataattatattgtcagataggaaatatgacagcccagttggaaattatttggccgaacgttctcaatcgaagcgat
catgtaggcttctgggaaagagagtggctcaaacatggcacctgtgggtatcccacaataaaggacgacatgcattattt
aaaaacagtaatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctcaaaggcgacgattcaaccgaacg
ggaataacaggtcactggtggatattgaaaatgccatacgcagtggtaacaacaatacgaaaccaaaattcaagtgccaa
aagaatactaggacgacgactgaattggttgaggtcactctttgcagtaatagagacttgactaagttcataaattgccc
ccacgggcctccaaaaggatcacgatatttctgccccgccaatgttaagtattaa
back to top
>AB308360.1-S4-RNase687
atgggaattacggggatgacatatatgtttacaatggtattgtcattaattgtattaatattctctgcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacaggaatggacctgacccagaaaaatgcaagactacaaccatg
aattctcagaagataggaaatatgacagcccagttggaaattatttggccgaacgttctcaatcgaagcgatcatgtagg
cttctgggaaagagagtggctcaaacatggcacctgtgggtatcccacaataaaggacgacatgcattatttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctcaaaggcgacgattcaaccgaacgggaataac
aggtcactggtggatattgaaaatgccatacgcagtggtaacaacaatacgaaaccaaaattcaagtgccaaaagaatac
taggacgacgactgaattggttgaggtcactctttgcagtaatagagacttgactaagttcataaattgcccccacgggc
ctccaaaaggatcacgatatttctgccccgccaatgttaagtattaa
back to top
>AB545981.1-S4-RNase.m5687
atgggaattacggggatgacatatatgtttacaatggtattgtcattaattgtattaatattctctgcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacaggaatggacctgacccagaaaaatgcaagactacaaccatg
aattctcagaagataggaaatatgacagcccagttggaaattatttggccgaacgttctcaatcgaagcgatcatgtagg
cttctgggaaagagagtggctcaaacatggcacctgtgggtatcccacaataaaggacgacatgcattatttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctcaaaggcgacgattcaaccgaacgggaataac
aggtcactggtggatattgaaaatgccatacgcagtggtaacaacaatacgaaaccaaaattcaagtgccaaaagaatac
taggacgacgactgaattggttgaggtcactctttgcagtaatagagacttgactaagttcataaattgcccccacgggc
ctccaaaaggatcacgatatttctgccccgccaatgttaagtattaa
back to top
>AB308360.1-S4-RNase.m1687
atgggaattacggggatgacatatatgtttacaatggtattgtcattaattgtattaatattctctgcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacaggaatggacctgacccagaaaaatgcaagactacaaccatg
aattctcagaagataggaaatatgacagcccagttggaaattatttggccgaacgttctcaatcgaagcgatcatgtagg
cttctgggaaagagagtggctcaaacatggcacctgtgggtatcccacaataaaggacgacatgcattatttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctcaaaggcgacgattcaaccgaacgggaataac
aggtcactggtggatattgaaaatgccatacgcagtggtaacaacaatacgaaaccaaaattcaagtgccaaaagaatac
taggacgacgactgaattggttgaggtcactctttgcagtaatagagacttgactaagttcataaattgcccccacgggc
ctccaaaaggatcacgatatttctgccccgccaatgttaagtattaa
back to top
>AB014072.1-S4-RNase.m1687
atgggaattacggggatgacatatatgtttacaatggtattgtcattaattgtattaatattctctgcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacaggaatggacctgacccagaaaaatgcaagactacaaccatg
aattctcagaagataggaaatatgacagcccagttggaaattatttggccgaacgttctcaatcgaagcgatcatgtagg
cttctgggaaagagagtggctcaaacatggcacctgtgggtatcccacaataaaggacgacatgcattatttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctcaaaggcgacgattcaaccgaacgggaataac
aggtcactggtggatattgaaaatgccatacgcagtggtaacaacaatacgaaaccaaaattcaagtgccaaaagaatac
taggacgacgactgaattggttgaggtcactctttgcagtaatagagacttgactaagttcataaattgcccccacgggc
ctccaaaaggatcacgatatttctgccccgccaatgttaagtattaa
back to top
>AB009385.1-S4-RNase.m1687
atgggaattacggggatgacatatatgtttacaatggtattgtcattaattgtattaatattctctgcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacaggaatggacctgacccagaaaaatgcaagactacaaccatg
aattctcagaagataggaaatatgacagcccagttggaaattatttggccgaacgttctcaatcgaagcgatcatgtagg
cttctgggaaagagagtggctcaaacatggcacctgtgggtatcccacaataaaggacgacatgcattatttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctcaaaggcgacgattcaaccgaacgggaataac
aggtcactggtggatattgaaaatgccatacgcagtggtaacaacaatacgaaaccaaaattcaagtgccaaaagaatac
taggacgacgactgaattggttgaggtcactctttgcagtaatagagacttgactaagttcataaattgcccccacgggc
ctccaaaaggatcacgatatttctgccccgccaatgttaagtattaa
back to top