S41-RNase, S41-RNase (gene) Prunus armeniaca

Gene Overview
Name S41-RNase
Gene Symbol S41-RNase
Type gene
Organism Prunus armeniaca
Synonym self-incompatibility S41-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S41-RNaseHQ342871.1-S41-RNase.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HQ342871.1-S41-RNase.m1 N/A HQ342871.1

Sequence(s):
>HQ342871.1-S41-RNase.m1189
tcactattcatggcctatggccaagtaattattcgaacccaaagatgcccagtaattgcatggggtcgcaatttaacgaa
agtaatttgtaccttaaattgcgatccaaactgaagatatcttggccggacgtggaaagtggaaatgacacaaatttttg
ggaaagagaatggaacaaacaaggcagct
back to top