S43-RNase, S43-RNase (gene) Malus x domestica

Gene Overview
Name S43-RNase
Gene Symbol S43-RNase
Type gene
Organism Malus x domestica
Synonym S43-RNase
Description NA
Comment self-incompatibility ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S43-RNaseEU427452.1-S43-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S43-RNaseEU427452.1-S43-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU427452.1-S43-RNase N/A EU427452.1
mRNA parsed from NCBI nr database EU427452.1-S43-RNase.m1 N/A EU427452.1

Sequence(s):
>EU427452.1-S43-RNase1018
tttacgcagcaatatcagccggcaatctgcaactctaatcctactccttgtaaggatcctactgagaaattgtttacggt
tcacggtttgtggccttcaaactctaatggacctgacccggtaaactgcaagccaaaaaccaaggtgcctcaggcgcagc
agccggtaatatatctgaaaattgaactttccccctctaaagacattttttctagcctataacccatcatatcatattta
tcgcaataagacccaataatcagaatccaactaaacaacttaccaaattagtttgtgtgtcatttttttgtattttttaa
atctgtaatatgccctcatctaagccagtatggaaagctcttgtaattacgttttaattgatggcatgcatccaatttgg
caaggtattgtagccacgaaatctagttctaaatgtaggaattaatttggaaatatttttcatttcaacaataaatttca
atttgaatatacctaattttagggtttaatttcaacaatatatattgtttaattttataaaaataacatagctacaatga
aacttacctacggtttatatttttttatgaaaaataatgtacctatctttgaatttttacaaagttaatgtatctgcttt
tttaatttttaacaaaactaatttaactacttccctttatagtattagtatacataatatgtagaacatatgtccgtata
tatttgatctaattcagttttggattgggggagttcacacaaaattaaaatatattaaacaaactaaatgtctgaaaaaa
tttataagagatatggtggcctgattttataaataaacacaaattcatggacatcttttttcaacatgacatcttattca
aattttgagtcttatttagtagtcatcatacatgtgggcttttgtctagaggttatcataaatttttttattgtatattt
tattttgtcagatagatgcatcactcaaaccccagttggaaattatttggccaaacgt
back to top
>EU427452.1-S43-RNase.m1212
tttacgcagcaatatcagccggcaatctgcaactctaatcctactccttgtaaggatcctactgagaaattgtttacggt
tcacggtttgtggccttcaaactctaatggacctgacccggtaaactgcaagccaaaaaccaaggtgcctcaggcgcagc
agccgatagatgcatcactcaaaccccagttggaaattatttggccaaacgt
back to top