S49-RNase, S49-RNase (gene) Malus sieversii

Gene Overview
Name S49-RNase
Gene Symbol S49-RNase
Type gene
Organism Malus sieversii
Synonym S49-RNase protein
S49-RNase
Description NA
Comment self-incompatibility ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S49-RNaseFJ535240.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099316.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099315.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099314.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099313.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099312.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099311.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099310.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099309.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099308.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099307.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099306.1-S49-RNase.m1Malus sieversiimRNA
S49-RNaseKT099305.1-S49-RNase.m1Malus sieversiimRNA


The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S49-RNaseKT099316.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099315.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099314.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099313.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099312.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099311.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099310.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099309.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099308.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099307.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099306.1-S49-RNaseMalus sieversiigene
S49-RNaseKT099305.1-S49-RNaseMalus sieversiigene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus sieversiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FJ535240.1-S49-RNase.m1 N/A FJ535240.1
gene parsed from NCBI nr database KT099316.1-S49-RNase N/A KT099316.1
gene parsed from NCBI nr database KT099315.1-S49-RNase N/A KT099315.1
gene parsed from NCBI nr database KT099314.1-S49-RNase N/A KT099314.1
gene parsed from NCBI nr database KT099313.1-S49-RNase N/A KT099313.1
gene parsed from NCBI nr database KT099312.1-S49-RNase N/A KT099312.1
gene parsed from NCBI nr database KT099311.1-S49-RNase N/A KT099311.1
gene parsed from NCBI nr database KT099310.1-S49-RNase N/A KT099310.1
gene parsed from NCBI nr database KT099309.1-S49-RNase N/A KT099309.1
gene parsed from NCBI nr database KT099308.1-S49-RNase N/A KT099308.1
gene parsed from NCBI nr database KT099307.1-S49-RNase N/A KT099307.1
gene parsed from NCBI nr database KT099306.1-S49-RNase N/A KT099306.1
gene parsed from NCBI nr database KT099305.1-S49-RNase N/A KT099305.1
mRNA parsed from NCBI nr database KT099316.1-S49-RNase.m1 N/A KT099316.1
mRNA parsed from NCBI nr database KT099315.1-S49-RNase.m1 N/A KT099315.1
mRNA parsed from NCBI nr database KT099314.1-S49-RNase.m1 N/A KT099314.1
mRNA parsed from NCBI nr database KT099313.1-S49-RNase.m1 N/A KT099313.1
mRNA parsed from NCBI nr database KT099312.1-S49-RNase.m1 N/A KT099312.1
mRNA parsed from NCBI nr database KT099311.1-S49-RNase.m1 N/A KT099311.1
mRNA parsed from NCBI nr database KT099310.1-S49-RNase.m1 N/A KT099310.1
mRNA parsed from NCBI nr database KT099309.1-S49-RNase.m1 N/A KT099309.1
mRNA parsed from NCBI nr database KT099308.1-S49-RNase.m1 N/A KT099308.1
mRNA parsed from NCBI nr database KT099307.1-S49-RNase.m1 N/A KT099307.1
mRNA parsed from NCBI nr database KT099306.1-S49-RNase.m1 N/A KT099306.1
mRNA parsed from NCBI nr database KT099305.1-S49-RNase.m1 N/A KT099305.1

Sequence(s):
>FJ535240.1-S49-RNase.m1537
tttacgcagcaatatcagccggctgcctgcaactccaatccaactccttgtaaggatcctcctgacaagttgtttactgt
tcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgccgccatatcagacgatgaaaatac
tcgaaccccagttggtaattatttggccgaacgtactcaatcgaaacgatcatgaagtcttctggcgtaaacagtgggat
aaacatggctcctgtgcgtcttccccaatacagaaccagacgcattactttgatacagtaatcaaaatgtacacaaccca
gaaacaaagcgtctctgaaatcctctcaaaggcgaatattaaaccgggtaggaaaagcaggagactggtggatattgaaa
atgccatacgcaatgttatcaacaatatgacaccaaaattcaagtgccaaaagaatactaggacatcattgactgaattg
gttgaggtcggtctttgcagcgatagcaacttaacgcagttcagaaactgcccccgc
back to top
>KT099316.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099315.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099314.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099313.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099312.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099311.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatt
atttg
back to top
>KT099310.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataaaaaatttaatatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099309.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099308.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099307.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
attgg
back to top
>KT099306.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcaaactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcatacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataataaatttattatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatataacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099305.1-S49-RNase405
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacggtaatattattagcataatcagatagtcaatattgtttatcacatttatgtacttgtgtgtgttta
tatttttggataatgttaggacgatcaaatttttaaactaaatgatgtgtcacaataggatataagaaatttagtatttc
tagcattactctatattttttgatatatacatatactcaacgcaggttttcatgcaggcgagtacaaatattacacttaa
tttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaaatactcgaaccccagttggtaatg
atttg
back to top
>KT099316.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgatttg
back to top
>KT099315.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgatttg
back to top
>KT099314.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgatttg
back to top
>KT099313.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgatttg
back to top
>KT099312.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgatttg
back to top
>KT099311.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaattatttg
back to top
>KT099310.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgatttg
back to top
>KT099309.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgatttg
back to top
>KT099308.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgatttg
back to top
>KT099307.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgattgg
back to top
>KT099306.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcaaactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcatacgatgaaaatactcgaaccccagttggtaatgatttg
back to top
>KT099305.1-S49-RNase.m1129
tcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaatgacccaaaatattgcaaggcgc
cgccatatcagacgatgaaaatactcgaaccccagttggtaatgatttg
back to top