S49-RNase, S49-RNase (gene) Prunus dulcis

Gene Overview
Name S49-RNase
Gene Symbol S49-RNase
Type gene
Organism Prunus dulcis
Synonym S49-RNase
Description NA
Comment ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S49-RNaseJX067634.2-S49-RNase.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus dulcisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JX067634.2-S49-RNase.m1 N/A JX067634.2

Sequence(s):
>JX067634.2-S49-RNase.m1330
cttgttcttggtttcgctttcttcttttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaatg
gccaccgaccaactgcagagttcgaacgaaatgctccaagccccggccattacaatatttcaccatccatggcctatggc
caagtaattattcaaacccaacgatgcccagtaattgcaatgggtcgaaatttgatgacaggaacgtgtctcctcaattg
cgaaacaaactgaaaagatcttggcccgacgtggaaagtggcaacgacacaaaattttgggaaggcgaatggaacaagcc
cagcacatat
back to top