S5-RNase, S5-RNase (gene) Prunus avium

Gene Overview
Name S5-RNase
Gene Symbol S5-RNase
Type gene
Organism Prunus avium
Synonym RNase S5
Description self-incompatibility
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus aviumgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S5-RNaseAJ298314.1-S5-RNase.m1Prunus aviummRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AJ298314.1-S5-RNase.m1 N/A AJ298314.1

Sequence(s):
>AJ298314.1-S5-RNase.m1681
atggcgatgttgaaatcgtcactcgctttacttgttcttgcttttgctttcttcttttgttatgttatgagcagtggatc
ttatgactattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgaacgaaatgctccaacccccggccat
tacaatatttcaccatccatggcctatggccaagtaattattcaaacccaaagatgcccagtaattgcattgggtcgcaa
tttaacgaaagtaaagtgtatccccgattgagatccaaattgaggatatcgtggccggacgtggaaagtggcaatgatac
aaagttttggggagacgaatggaacaaacatggtacatgttcccaacggatccttaaccaattccaatactttgagcgat
cccagcaaatgtggagatcttacaatattacaaatatccttaaaaaagctcaaatcgtaccaaatgcgacacaaacgtgg
agctactcggacatagtatcacccattaagacagcaactaacagaacacctctccttcgttgcaaatctcagcctaagag
ccaagcgaattttcagttgttacatgaagtggtactttgttttgattataatgcgctagtacatattgactgtaatcgaa
cagcaggatgctggaataacgttgacattaagtttcaataa
back to top