S5-RNase, S5-RNase (gene) Prunus humilis

Gene Overview
Name S5-RNase
Gene Symbol S5-RNase
Type gene
Organism Prunus humilis
Synonym self-incompatibility S5-RNase
Description NA
Comment ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S5-RNaseEF595836.1-S5-RNase.m1Prunus humilismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus humilisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF595836.1-S5-RNase.m1 N/A EF595836.1

Sequence(s):
>EF595836.1-S5-RNase.m1186
tcaccattcatggaaaatggacaagtaattattcaaatccaacgatccccagtaattgccctgggtcgcaatttaagaaa
atattgtcccctcagttgcgatccagtctgatgaggtcttggcccgacgtggaaggtggcaatgatacaaaattttggga
aggcgaatggaacaaacacggtactt
back to top