S5-RNase, S5-RNase (gene) Pyrus pyrifolia

Gene Overview
Name S5-RNase
Gene Symbol S5-RNase
Type gene
Organism Pyrus pyrifolia
Synonym S5-RNase
Description self-incompatibility
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S5-RNaseAB045711.1-S5-RNasePyrus pyrifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S5-RNaseAB002141.1-S5-RNase.m1Pyrus pyrifoliamRNA
S5-RNaseAB045711.1-S5-RNase.m1Pyrus pyrifoliamRNA
S5-RNaseD88282.1-S5-RNase.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB045711.1-S5-RNase N/A AB045711.1
mRNA parsed from NCBI nr database AB002141.1-S5-RNase.m1 N/A AB002141.1
mRNA parsed from NCBI nr database AB045711.1-S5-RNase.m1 N/A AB045711.1
mRNA parsed from NCBI nr database D88282.1-S5-RNase.m1 N/A D88282.1

Sequence(s):
>AB045711.1-S5-RNase863
atggggattacggggatggtatatgtggttacgatggtatttttattaattgtgttaatattgtcttcgtccacagtggg
atacgattattttcaatttacgcagcaatatcagctggcggtctgcaactctaatcgtactccttgtaaggatcctccgg
acaagttgtttacggttcacggtttgtggccctcaagcatggcaggacctgacccaagtaattgcccgataaggaacatt
cggaaggtaatattattagtaatcagatcgtcaatattgtttatttcctttatgtacttgtgcgtgtgtttgtgtatatt
caatatatacgtcctcaaacatagattttcatgcacgtgtgtacaaatattacaattagttttaaatataatcataattt
tttttttttcttttgtgcataccagagagaaaaattactcgaaccccagctggcaattatttggccgaacgtattcgatc
gaaccaaaaataaactcttctgggataaagagtggatgaaacatggcacctgtgggtatcccacaatagataacgagaac
cattactttgaaaccgtaatcaaaatgtacatcagcaagaaacaaaacgtctctagaatcctctcaaaggcgaagattga
accggacgggaaaaaaagagcactgttggatattgaaaatgccatacgcaatggtgccgacaataagaaaccaaaactca
agtgccaaaagaagggtacgacgactgaattagttgagatcactctttgcagtgacaaaagcggagaacatttcatagat
tgcccccacccctttgaaccaatatcaccacattattgccccaccaacaatatcaagtattaa
back to top
>AB002141.1-S5-RNase.m1684
atggggattacggggatggtatatgtggttacgatggtatttttattaattgtgttaatattgtcttcgtccacagtggg
atacgattattttcaatttacgcagcaatatcagctggcggtctgcaactctaatcgtactccttgtaaggatcctccgg
acaagttgtttacggttcacggtttgtggccctcaagcatggcaggacctgacccaagtaattgcccgataaggaacatt
cggaagagagaaaaattactcgaaccccagctggcaattatttggccgaacgtattcgatcgaaccaaaaataaactctt
ctgggataaagagtggatgaaacatggcacctgtgggtatcccacaatagataacgagaaccattactttgaaaccgtaa
tcaaaatgtacatcagcaagaaacaaaacgtctctagaatcctctcaaaggcgaagattgaaccggacgggaaaaaaaga
gcactgttggatattgaaaatgccatacgcaatggtgccgacaataagaaaccaaaactcaagtgccaaaagaagggtac
gacgactgaattagttgagatcactctttgcagtgacaaaagcggagaacatttcatagattgcccccacccctttgaac
caatatcaccacattattgccccaccaacaatatcaagtattaa
back to top
>AB045711.1-S5-RNase.m1684
atggggattacggggatggtatatgtggttacgatggtatttttattaattgtgttaatattgtcttcgtccacagtggg
atacgattattttcaatttacgcagcaatatcagctggcggtctgcaactctaatcgtactccttgtaaggatcctccgg
acaagttgtttacggttcacggtttgtggccctcaagcatggcaggacctgacccaagtaattgcccgataaggaacatt
cggaagagagaaaaattactcgaaccccagctggcaattatttggccgaacgtattcgatcgaaccaaaaataaactctt
ctgggataaagagtggatgaaacatggcacctgtgggtatcccacaatagataacgagaaccattactttgaaaccgtaa
tcaaaatgtacatcagcaagaaacaaaacgtctctagaatcctctcaaaggcgaagattgaaccggacgggaaaaaaaga
gcactgttggatattgaaaatgccatacgcaatggtgccgacaataagaaaccaaaactcaagtgccaaaagaagggtac
gacgactgaattagttgagatcactctttgcagtgacaaaagcggagaacatttcatagattgcccccacccctttgaac
caatatcaccacattattgccccaccaacaatatcaagtattaa
back to top
>D88282.1-S5-RNase.m1684
atggggattacggggatggtatatgtggttacgatggtatttttattaattgtgttaatattgtcttcgtccacagtggg
atacgattattttcaatttacgcagcaatatcagctggcggtctgcaactctaatcgtactccttgtaaggatcctccgg
acaagttgtttacggttcacggtttgtggccctcaagcatggcaggacctgacccaagtaattgcccgataaggaacatt
cggaagagagaaaaattactcgaaccccagctggcaattatttggccgaacgtattcgatcgaaccaaaaataaactctt
ctgggataaagagtggatgaaacatggcacctgtgggtatcccacaatagataacgagaaccattactttgaaaccgtaa
tcaaaatgtacatcagcaagaaacaaaacgtctctagaatcctctcaaaggcgaagattgaaccggacgggaaaaaaaga
gcactgttggatattgaaaatgccatacgcaatggtgccgacaataagaaaccaaaactcaagtgccaaaagaagggtac
gacgactgaattagttgagatcactctttgcagtgacaaaagcggagaacatttcatagattgcccccacccctttgaac
caatatcaccacattattgccccaccaacaatatcaagtattaa
back to top