S51-RNase, S51-RNase (gene) Malus kansuensis

Gene Overview
Name S51-RNase
Gene Symbol S51-RNase
Type gene
Organism Malus kansuensis
Synonym S51-RNase protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S51-RNaseFJ535242.1-S51-RNase.m1Malus kansuensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus kansuensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FJ535242.1-S51-RNase.m1 N/A FJ535242.1

Sequence(s):
>FJ535242.1-S51-RNase.m1540
tttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctactgacaagttgtttacggt
tcacggtttgtggccttcaaacaggaatggacctgacccagaaaaatgcaagactacaaccatgaattctcagaagatag
gaaatatgacagcccagttggaaattatttggccgaacgttctcaatcgaagcgatcatgtaggcttctgggaaagagag
tggctcaaacatggcacctgtgggtatcccacaataaaggacgacatgcattatttaaaaacagtaatcaaaatgtacat
aacccagaaacaaaacgtctctgcaattctctcaaaggcgacgattcaaccgaacgggaataacaggtcactggtggata
ttgaaaatgccttgcgcagtggtaacaacaatacgaaaccaaaattcaagtgccaaaagaatactaggacgacgactgaa
ttggttgaggtcactctttgcagtaatagagacttgactaagttcataaactgcccccgc
back to top