S6-RNase, S6-RNase (gene) Prunus webbii

Gene Overview
Name S6-RNase
Gene Symbol S6-RNase
Type gene
Organism Prunus webbii
Synonym S6 S-RNase
S6-RNase
Description NA
Comment ribonuclease; Pw6 S-RNase; self-incompatibility related
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus webbiigene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S6-RNaseDQ118148.1-S6-RNase.m1Prunus webbiimRNA
S6-RNaseEU294327.1-S6-RNase.m1Prunus webbiimRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ118148.1-S6-RNase.m1 N/A DQ118148.1
mRNA parsed from NCBI nr database EU294327.1-S6-RNase.m1 N/A EU294327.1

Sequence(s):
>DQ118148.1-S6-RNase.m1510
gtgcaacaatggccaccgacaaactgcagagttcgcatcaagcgaccttgctccaatccccggccactacaatatttcac
catccatggcctatggccaagtaactattcaaacccaacgaagcccagtaattgcaatgggtcgcaatttaactttacga
aagtgtcccctaaaatgcgagtcaaactgaagagatcttggcccgacgtggaaagtggcaatgatacaaggttttgggaa
ggcgaatggaacaaacatggtacatgttcggaaggttcacttaaccaaatgcaatacttcgagcgatcccacgaaatgtg
gtactcgttcaatattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggaagtactcagaca
tagtagcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaaacctgatccagcacagaataagagcggg
ccgaagactcagttgttacatgaagtggta
back to top
>EU294327.1-S6-RNase.m1567
cttgttcttggtttcgctttcttcttttgttacgttatgtgcagtggatcttatgactattttcaatttgtgcaacaatg
gccgccgaccaactgcaaaattcgcacgaaatgctccaaaccccggccattacaaatgttcaccatccatggcctatggc
caagtaattattcaaacccaaagatgcccagtaattgcatggggtcgcgatttaacgagagtaacttgtcccctaaattg
cgatccaaactgaagagatcttggccggacgtggaaagtggcaatgatacaaaattttgggaaggcgaatggaacaagca
tggtaaatgttccgaacagacacttaaccaaatgcaatacttccagcgatcccacgaaatgtggtatacgtccaatatta
caggtatccttaaaaacgcttcaatcgtaccaagtgcgacacgatggaagtactcggacatagtatcagccattaaaaca
gcaactaaaagaacacccctccttcgttgcaaaactgaggtagcaagtaatattgataatattgagttgttacatgaagt
ggtattt
back to top