S6-RNase, S6-RNase (gene) Pyrus pyrifolia

Gene Overview
Name S6-RNase
Gene Symbol S6-RNase
Type gene
Organism Pyrus pyrifolia
Synonym S6-RNase
Description self-incompatibility
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus pyrifoliagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S6-RNaseAB002142.1-S6-RNase.m1Pyrus pyrifoliamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB002142.1-S6-RNase.m1 N/A AB002142.1

Sequence(s):
>AB002142.1-S6-RNase.m1690
atggggattacggggatgatatatatggttccgatggtattttcgttaattgtattaatatcgtgttcgtctacgatggg
ttacaattattttcaatttacgcagcaatatcagccggctgtctgcaactctaatcctactccttgtaaggatcctcctg
acaagttgtttaccgttcacggtttgtggccttcaaacgacgtaggagatgacccaatatactgcaagaataaaaccatt
aaatctcagcagatagggaatctgactgcccagttgataattatttggccgaacgtgctcgatcgaaccgatcatgtagg
cttctggaatagacagtggaacaaacatggcagctgtgggaaagcgcccacaataaaggacgaaatgcattactttaaaa
cagtaatcaaaatgtacataacccagaaacaaaacgtttctgaaatcctctcaagggcgaagattgaaccggaggggaaa
atcaggagacgggatgatattataaatgccatacgcctaggtaccaaagataagaaaccaaaactcaagtgccaaaagaa
taatcagacgactgaattggtcgagatcactatttgcagcgatcgcaacctaacgcagttcatagactgcccccgcagtt
cttttaaaggatcaccatttcactgccccaccaatcatattctgtattaa
back to top