S7-RNase, S7-RNase (gene) Malus x domestica

Gene Overview
Name S7-RNase
Gene Symbol S7-RNase
Type gene
Organism Malus x domestica
Synonym S7-RNase
S7-ribonuclease
Description pistil rejection of S7 pollen
Comment self-incompatibility ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S7-RNaseHQ689394.1-S7-RNaseMalus x domesticagene
S7-RNaseHQ689393.1-S7-RNaseMalus x domesticagene
S7-RNaseHQ689392.1-S7-RNaseMalus x domesticagene
S7-RNaseHQ689391.1-S7-RNaseMalus x domesticagene
S7-RNaseEU427457.1-S7-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S7-RNaseU19792.1-S7-RNase.m1Malus x domesticamRNA
S7-RNaseHQ689394.1-S7-RNase.m1Malus x domesticamRNA
S7-RNaseHQ689393.1-S7-RNase.m1Malus x domesticamRNA
S7-RNaseHQ689392.1-S7-RNase.m1Malus x domesticamRNA
S7-RNaseHQ689391.1-S7-RNase.m1Malus x domesticamRNA
S7-RNaseEU427457.1-S7-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HQ689394.1-S7-RNase N/A HQ689394.1
gene parsed from NCBI nr database HQ689393.1-S7-RNase N/A HQ689393.1
gene parsed from NCBI nr database HQ689392.1-S7-RNase N/A HQ689392.1
gene parsed from NCBI nr database HQ689391.1-S7-RNase N/A HQ689391.1
gene parsed from NCBI nr database EU427457.1-S7-RNase N/A EU427457.1
mRNA parsed from NCBI nr database U19792.1-S7-RNase.m1 N/A U19792.1
mRNA parsed from NCBI nr database HQ689394.1-S7-RNase.m1 N/A HQ689394.1
mRNA parsed from NCBI nr database HQ689393.1-S7-RNase.m1 N/A HQ689393.1
mRNA parsed from NCBI nr database HQ689392.1-S7-RNase.m1 N/A HQ689392.1
mRNA parsed from NCBI nr database HQ689391.1-S7-RNase.m1 N/A HQ689391.1
mRNA parsed from NCBI nr database EU427457.1-S7-RNase.m1 N/A EU427457.1

Sequence(s):
>HQ689394.1-S7-RNase320
ttttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacgg
ttcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaaggta
atcttatcaataatctaatactcaacatatatgttcatacaagtgcaaatattacaattaatttcaatttaatcataaat
gttttctatttatatatttttatttatattggcagttaggaaatctgacaactcagttggaaatgatttggccgaacgta
back to top
>HQ689393.1-S7-RNase320
ttttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacgg
ttcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaaggta
atcttatcaataatctaatactcaacatatatgttcatacaagtgcaaatattacaattaatttcaatttaatcataaat
gttttctatttatatatttttatttatattggcagttaggaaatctgacaactcagttggaaatgatttggccgaacgta
back to top
>HQ689392.1-S7-RNase320
ttttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacgg
ttcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaaggta
atcttatcaataatctaatactcaacatatatgttcatacaagtgcaaatattacaattaatttcaatttaatcataaat
gttttctatttatatatttttatttatattggcagttaggaaatctgacaactcagttggaaatgatttggccgaacgta
back to top
>HQ689391.1-S7-RNase320
ttttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacgg
ttcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaaggta
atcttaccaataatctaatactcaacatatatgttcatacaagtgcaaatattacaattaatttcaatttaatcataagt
gttttctatttatatatttttatttatattggcagttaggaaatctgacaactcagttggaaatgatttggccgaacgta
back to top
>EU427457.1-S7-RNase318
tttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacggt
tcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaaggtaa
tcttatcaataatctaatactcaacatatatgttcatacaagtgcaaatattacaattaatttcaatttaatcataaatg
ttttctatttatatatttttatttatattggcagttaggaaatctgacaactcagttggaaataatttggccgaacgt
back to top
>U19792.1-S7-RNase.m1542
ttaaggatcctcctgacaagttgtttacggttcacggtttgtggccttcagactcgaatggacatgacccagtaaattgc
agtaaatcaaccgtggatgctcagaagttaggaaatctgacaactcagttggaaataatttggccgaacgtatacaatcg
aaccgatcatataagcttctgggataaacagtggaacaaacatggcacctgtggacatcccacaataatgaacgacattc
attactttcaaacagtaatcaaaatgtacataacccagaaacaaaacgtctctaaaatcctctcaagggcgaagattgaa
ccggagggaaaacccaggaaacaggtagatattgtaaatgccatacgcaaaggtacaaacgataaggaaccaaaactcaa
gtgccaaaagaataaccaggtgactgaattggttgaggtcactctttgcagtaatcgcaacctaacggggttcataaatt
gcccccgccatattccaaatggatcacgatattcctgccccaccaaaaatattctgtattaa
back to top
>HQ689394.1-S7-RNase.m1202
ttttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacgg
ttcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaagtta
ggaaatctgacaactcagttggaaatgatttggccgaacgta
back to top
>HQ689393.1-S7-RNase.m1202
ttttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacgg
ttcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaagtta
ggaaatctgacaactcagttggaaatgatttggccgaacgta
back to top
>HQ689392.1-S7-RNase.m1202
ttttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacgg
ttcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaagtta
ggaaatctgacaactcagttggaaatgatttggccgaacgta
back to top
>HQ689391.1-S7-RNase.m1202
ttttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacgg
ttcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaagtta
ggaaatctgacaactcagttggaaatgatttggccgaacgta
back to top
>EU427457.1-S7-RNase.m1200
tttacgcagcaatatcagttggctgcctgcaactctaaacctattccttgtaaggatcctcctgacaagttgtttacggt
tcacggtttgtggccttcagactcgaatggacatgacccagtaaattgcagtaaatcaaccgtggatgctcagaagttag
gaaatctgacaactcagttggaaataatttggccgaacgt
back to top