S7-RNase, S7-RNase (gene) Prunus humilis

Gene Overview
Name S7-RNase
Gene Symbol S7-RNase
Type gene
Organism Prunus humilis
Synonym S7-RNase
Description NA
Comment ribonuclease; self-incompatibility RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S7-RNaseEF601047.1-S7-RNase.m1Prunus humilismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus humilisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF601047.1-S7-RNase.m1 N/A EF601047.1

Sequence(s):
>EF601047.1-S7-RNase.m1189
tcaccattcatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcaaaatatgaggac
aggaaagtgtaccctaaattgcgatccaaactcaagagatcttggcccgacgtggaaagtggcaatgatacaagattttg
ggaaggcgaatggaacaagcatggcacat
back to top