S7-RNase, S7-RNase (gene) Prunus spinosa

Gene Overview
Name S7-RNase
Gene Symbol S7-RNase
Type gene
Organism Prunus spinosa
Synonym S7-2 RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S7-RNaseEU833958.1-S7-RNasePrunus spinosagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S7-RNaseEU833958.1-S7-RNase.m1Prunus spinosamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus spinosagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU833958.1-S7-RNase N/A EU833958.1
mRNA parsed from NCBI nr database EU833958.1-S7-RNase.m1 N/A EU833958.1

Sequence(s):
>EU833958.1-S7-RNase1212
ctgcatgtcctctttatattttcatcgtgtttggttttattctgataactgttgcaataactgcagtctatcacaataat
tttggcaggatcttatgactattttcaatttgtgcaacaatggccaccgaccagctgcagagctcccaagaaatgctcca
aaccccggccattacaaaacttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgc
aatggaacgaaatttaagatacagaatttggtatgtattgttttttttctttggctcgtgtttgttttcagaaaattaga
ttgtcatatctgaaaataatataattttgggggtaacataaaattttacgctggccctctaatgaggtacatatcgtaag
tataaagttggaagtacattcatatatgcatttttttttaatacaaatgatattatactttataatctaatataaattac
ggggagagggattcgaactcgaatgagtgggggggagcatatccgctctagccaacttggcaaaggtaagaccatatgcc
tgcttatatacgcattttataataatatatctgatcatttaataaagggatttaccattttgtactagcgaatattatca
aaatattgtacttaaatgagatgataaaaatgaaaaaaaaaagggggatagatttaataataaaaaatttcttatccaat
aatgaaaatctaattatcccttacgtttttactgttttctggaaatatgtatatattgcttggatgcctcagtaccctta
tttgcgatccaaaatgaagatagcttggccggacgtggaaagtggcaatgatacaaggttttgggaaagggaatggaaca
aacatggtacatgttccgaacggatacttaacctaatgcaatacttccggcgatccttcgcaatgtggaaatcacacaat
attacggagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacctactcggacatagtatcacccat
taaagcagcaactaaaagaacacccctccttcgttgcaaacgtgatccagcacaaccgaatatgcagtggttacatgaag
tagtattttgttatgaatataatgcgttaaagcagattgactgtaatcggacaacaggatgcaaaaatcaacaagccatc
tcgtttcaataa
back to top
>EU833958.1-S7-RNase.m1602
gatcttatgactattttcaatttgtgcaacaatggccaccgaccagctgcagagctcccaagaaatgctccaaaccccgg
ccattacaaaacttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatggaac
gaaatttaagatacagaatttgtacccttatttgcgatccaaaatgaagatagcttggccggacgtggaaagtggcaatg
atacaaggttttgggaaagggaatggaacaaacatggtacatgttccgaacggatacttaacctaatgcaatacttccgg
cgatccttcgcaatgtggaaatcacacaatattacggagatccttaaaaacgcttcaatcgtaccacatccgacacaaac
atggacctactcggacatagtatcacccattaaagcagcaactaaaagaacacccctccttcgttgcaaacgtgatccag
cacaaccgaatatgcagtggttacatgaagtagtattttgttatgaatataatgcgttaaagcagattgactgtaatcgg
acaacaggatgcaaaaatcaacaagccatctcgtttcaataa
back to top