S7-RNase, S7-RNase (gene) Prunus webbii

Gene Overview
Name S7-RNase
Gene Symbol S7-RNase
Type gene
Organism Prunus webbii
Synonym S7 S-RNase
S7-RNase
Description NA
Comment ribonuclease; PwS7 S-RNase; self-incompatibility related
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S7-RNaseDQ118149.1-S7-RNase.m1Prunus webbiimRNA
S7-RNaseEU294328.1-S7-RNase.m1Prunus webbiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus webbiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ118149.1-S7-RNase.m1 N/A DQ118149.1
mRNA parsed from NCBI nr database EU294328.1-S7-RNase.m1 N/A EU294328.1

Sequence(s):
>DQ118149.1-S7-RNase.m1489
gtgcaacaatggccaccgactaactgcagagttcgcaataaaccttgctccaaaccccggccattacaaatcttcaccat
ccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggccgcaatttaagcctatattgt
cccctcgattgcgttccaaactgaagatatcttggcccgacgtggaaagtggcaatgatacaaagttttgggaagcggaa
tggaacaaacatggtacatgttccgaacagacactaaaccaattccaatacttcgaccgatcctacgcaatgtggagatc
gtacaatattacagaaatccttaaaaacgctacaatcgttccaagtccgacacaaacatggaagtattcggacatagtat
cacccattaaaacagcaactaaaagaacacccctcttacgttgcagaaaggatccagcacagaattctcagttgttacat
gaagtggta
back to top
>EU294328.1-S7-RNase.m1462
cttgttcttggttttgctttcttctcgtgtttaattatgagcactggatcttatgcctattttcaatttgtgcaacaatg
gccaccgaccacttgcagaattagcaataaatcttgccaccaacagcgaccgttacaaatgttcaccatccatggcctat
ggccaagtaattattcaaacccaaggaagcccagtagttgcaccgggtcgcaatttaagttagagaaattgtacccgaaa
ttgcgatccaaactgaagatatcttggcccaacgtcgaaagcgggaatgataccaagttttgggaatgcgaatggaacaa
acacggtacgtgttccgaacagacacttaaccaattccaatacttccagcgatcccacggaatctggaacgcgtacaata
tgacaaatatccttaaaagggctcaaatcataccaagtgcgacaaatacgtggaagtactcg
back to top