S9-RNase, S9-RNase (gene) Malus x domestica

Gene Overview
Name S9-RNase
Gene Symbol S9-RNase
Type gene
Organism Malus x domestica
Synonym S9-RNase
Description pistil rejection of S9 pollen
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S9-RNaseAB270792.1-S9-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S9-RNaseU19793.1-S9-RNase.m1Malus x domesticamRNA
S9-RNaseAB270792.1-S9-RNase.m3Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB270792.1-S9-RNase N/A AB270792.1
mRNA parsed from NCBI nr database U19793.1-S9-RNase.m1 N/A U19793.1
mRNA parsed from NCBI nr database AB270792.1-S9-RNase.m3 N/A AB270792.1

Sequence(s):
>AB270792.1-S9-RNase687
atggggattacggggatgatatatatggttactatggtattttcattaattgtattaatattgtcttcccctacggtagg
atacgattattttcaatttacgcagcaatatcagccggctgtctgccactttaatcctactccttgtagagatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagctcaggaaatgacccaatatactgcaagaatacaaccatg
aattctactaagatagcaaatctgacagcccggttggaaattatttggcccaacgtactcgatcgaaccgatcatataac
cttctggaataaacagtggaacaaacatggcagctgtgggcatcccgcaatacagaacgacatgcattatttgcaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgaaatcctctcaaaggcgaagattgaaccggtggggaaattc
aggacacagaaggaaattgaaaaggccatacgcaaaggtaccaataataaggaacccaaactcaagtgccaaaagaatag
tcagaggactgaattggttgaggtcactatttgtagcgatcgcaacttaaaccagttcatagattgtccccgccctattt
taaatggatcacgatactactgccccaccaataatattctgtattaa
back to top
>U19793.1-S9-RNase.m1687
atggggattacggggatgatatatatggttactatggtattttcattaattgtattaatattgtcttcccctacggtagg
atacgattattttcaatttacgcagcaatatcagccggctgtctgccactttaatcctactccttgtagagatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagctcaggaaatgacccaatatactgcaagaatacaaccatg
aattctactaagatagcaaatctgacagcccggttggaaattatttggcccaacgtactcgatcgaaccgatcatataac
cttctggaataaacagtggaacaaacatggcagctgtgggcatcccgcaatacagaacgacatgcattatttgcaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgaaatcctctcaaaggcgaagattgaaccggtggggaaattc
aggacacagaaggaaattgaaaaggccatacgcaaaggtaccaataataaggaacccaaactcaagtgccaaaagaatag
tcagaggactgaattggttgaggtcactatttgtagcgatcgcaacttaaaccagttcatagattgtccccgccctattt
taaatggatcacgatactactgccccaccaataatattctgtattaa
back to top
>AB270792.1-S9-RNase.m3687
atggggattacggggatgatatatatggttactatggtattttcattaattgtattaatattgtcttcccctacggtagg
atacgattattttcaatttacgcagcaatatcagccggctgtctgccactttaatcctactccttgtagagatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagctcaggaaatgacccaatatactgcaagaatacaaccatg
aattctactaagatagcaaatctgacagcccggttggaaattatttggcccaacgtactcgatcgaaccgatcatataac
cttctggaataaacagtggaacaaacatggcagctgtgggcatcccgcaatacagaacgacatgcattatttgcaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgaaatcctctcaaaggcgaagattgaaccggtggggaaattc
aggacacagaaggaaattgaaaaggccatacgcaaaggtaccaataataaggaacccaaactcaagtgccaaaagaatag
tcagaggactgaattggttgaggtcactatttgtagcgatcgcaacttaaaccagttcatagattgtccccgccctattt
taaatggatcacgatactactgccccaccaataatattctgtattaa
back to top