S9-RNase, S9-RNase (gene) Malus sylvestris

Gene Overview
Name S9-RNase
Gene Symbol S9-RNase
Type gene
Organism Malus sylvestris
Synonym S9'-RNase
Description NA
Comment self-incompatibility ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S9-RNaseEU419868.1-S9-RNase.m1Malus sylvestrismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus sylvestrisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU419868.1-S9-RNase.m1 N/A EU419868.1

Sequence(s):
>EU419868.1-S9-RNase.m1200
tttacgcagcaatatcagccggctgtctgccgctttaatcctactccttgtaaggatcctcctgacaagttgtttacggt
tcacggtttgtggccttcaaacagcacaggaaatgacccaacatactgcaagaatacaaccttgaattctactaagttag
caaatctgacagcccagttggaaattatttggcccaacgt
back to top