S9-RNase, S9-RNase (gene) Prunus armeniaca

Gene Overview
Name S9-RNase
Gene Symbol S9-RNase
Type gene
Organism Prunus armeniaca
Synonym self-incompatibility RNase S9
S9-RNase
S9-RNase protein
Description NA
Comment S9-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S9-RNaseEF101910.1-S9-RNase.m1Prunus armeniacamRNA
S9-RNaseEF053410.1-S9-RNase.m1Prunus armeniacamRNA
S9-RNaseDQ269996.1-S9-RNase.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF101910.1-S9-RNase.m1 N/A EF101910.1
mRNA parsed from NCBI nr database EF053410.1-S9-RNase.m1 N/A EF053410.1
mRNA parsed from NCBI nr database DQ269996.1-S9-RNase.m1 N/A DQ269996.1

Sequence(s):
>EF101910.1-S9-RNase.m1157
tacttgttcttggtttcgctttcttcttgtgtttcattatgagcactggatcttacgtgtattttcaatttgtgcaacaa
tggccaccgacgacctgcagacttagcagcaaaccttccaaccaacaccggccattacaaaacttcaccatccatga
back to top
>EF053410.1-S9-RNase.m1564
tcccttgttcttggttttgctttcttcttgtgtttcattatgagcactggatcttacgtgtattttcaatttgtgcaaca
atggccaccgacgacctgcagacttagcagcaaaccttccaaccaacaccggccattacaaagattcaccatccatggcc
tatggccaagtaactattcaaacccaaggaagcccagtaattgcaatgggtcgcgatttaactttaggaaagtgtaccct
caattgcgaaataaactgaagatatcttggcccgacgtggaaggtggcaacgatacaaaattttgggaaggtgaatggaa
caaacatggcacatgttccgaagagagacttaaccaaatgcaatacttcgaacgatcccacaacatttggatgtcgtaca
gtattgcagagatccttaaaaacgcttcaatcgtaccgcatccgacacaaacatggaagtactcggacatagtatcaccc
attaaaacagcaactggaagaacacccctccttcgttgcaaatacgataagagcactcagctgttacatgaagtggtatt
ttga
back to top
>DQ269996.1-S9-RNase.m1191
ttcacaattcatggcctatggccaagtaactattcaaacccaaggaggcccagtaattgcaatgggtcgcgatttaactt
taggaaagtgtaccctcaattgcgaaataaactgaagatatcttggcccgacgtggaaggtggcaacgatacaaaatttt
gggaaggtgaatggaacaaacacggtactta
back to top