S9-RNase, S9-RNase (gene) Prunus avium

Gene Overview
Name S9-RNase
Gene Symbol S9-RNase
Type gene
Organism Prunus avium
Synonym RNase S9
Description self-incompatibility
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S9-RNaseKJ590779.1-S9-RNasePrunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S9-RNaseKJ590779.1-S9-RNase.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KJ590779.1-S9-RNase N/A KJ590779.1
mRNA parsed from NCBI nr database KJ590779.1-S9-RNase.m1 N/A KJ590779.1

Sequence(s):
>KJ590779.1-S9-RNase258
aaacaattgtgtgtctgatgatagatcacatgacatgttgaattcacccacatatttttcatttaatcaaacgcacaact
ttatatggatgagtaagtattcggggattgctttcgtgcatgtcctcttttgtttattctgataattgttgcaataagtg
cagtctattcatcacaataattttcgcaggatcttacgactattttcaatttgtgcaacaatggccgccgaccaactgca
gagctcgaaagagacctt
back to top
>KJ590779.1-S9-RNase.m169
gatcttacgactattttcaatttgtgcaacaatggccgccgaccaactgcagagctcgaaagagacctt
back to top