S9-RNase, S9-RNase (gene) Prunus salicina

Gene Overview
Name S9-RNase
Gene Symbol S9-RNase
Type gene
Organism Prunus salicina
Synonym S9-RNase
Description NA
Comment S-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus salicinagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S9-RNaseAY996051.1-S9-RNase.m1Prunus salicinamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY996051.1-S9-RNase.m1 N/A AY996051.1

Sequence(s):
>AY996051.1-S9-RNase.m1283
ggccaagtaattattcaaacccaaacaagcctagtaattgcattgggtcgcgatttaagaaagagaacgtgtctcctcaa
ttgcgagccaaattggtgagatcttggcccgacgcggaaagtggcaatgatacaaggttttgggaaggcgaatggaacaa
acatggcagatgttcccaacagacactgaaccaattccaatacttccagcgatcctatgcaatgtggagatcctacaata
ttacaaatattcttaaaatggcttcaatcgtaccacatccgac
back to top