SBP1, SBP1 (gene) Malus x domestica

Gene Overview
Name SBP1
Gene Symbol SBP1
Type gene
Organism Malus x domestica
Synonym S-RNase binding protein 1
MdSBP1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SBP1AB763431.1-SBP1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-RNase binding proteinSBPMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AB763431.1-SBP1.m1 Chr08:8289573..8292417
chr8:13140911..13143698
chr8:13137894..13140748
chr8:15306215..15309069
AB763431.1

Sequence(s):
>AB763431.1-SBP1.m11026
atggctgttccccagcaccatttccaacagcactacccaccccaacaacagcagcaacaatccaagtctttcagaaattt
gtacacaatcgacggccagatgtcgccggcggtggcgtattacgaccccggcaatttacacgatcacccccagcagcagc
atcctccttacgttccgccctttcatgtagtaggatttgcgcccggtccggtggctgcaacggatggcagcgataattgc
gccgatttgcagtgtcattatgggttcgaatccaaaaggaaaaagctaaaggaacaggatttcctggaaaacaactcaca
aatatcgtccattgatttcctgcaaccgcaatcggtctccacaggcttgggtttgtcccttgacaatactcgaatggctt
ctacaggggactcatcgttgctgtcacttatcagtgatgacattgatcatgagctacaacgacaggatgctgagattgat
agattcctcaaggcccagggtgaccgactgcggcaaactatcatggacaaggtccaagccacacaacttcagaccctctc
ggctgtggaagacaaagttcatcggaagctgcgagagaaagaagcagaagtggagagcattaacgagaagaatatggagc
ttgaagagcgaatggaacagttgactgttgaagcaggtgcttggcaacagctagccaggcacaatgaaaacatgatctca
actctaaggtttaatcttcagcatatatatgctcaaagtagagatagtaaagaaggatgtggcgacagtgaggtagatga
tacagcttcttgctgcaatggccgttcgatcaatttggaaatgttttgcaaggagaataatgacgggaaagagatgatga
cttgcaaggcctgccgagtcaatgaagtgtgcatgcttctattaccttgtaagcatctttgcctgtgcaaagattgtgaa
agtaagctcagcatctgccctctctgtcagtcctctaagtttatcagcatggaggtatatttgtaa
back to top